Loading...

Summer Research Fellowship Programme of India's Science Academies

Systems biology of rho-dependent termination in Escherichia coli

Aradhana Behera

Banaras Hindu University, Varanasi, Uttar Pradesh 221005

Dr. Ranjan Sen

Centre for DNA Fingerprinting and Diagnostics(CDFD), Hyderabad, Telangana 500039

Abstract

In bacteria, transcription takes place in three steps, that are, initiation, elongation and termination. The termination process can occur via extrinsic or intrinsic pathway. Extrinsic termination involves a hexameric protein called Rho. It is a RNA dependent helicase that binds to mRNA at rut site, translocate along the RNA towards the elongation complex by its ATP dependent helicase activity and eventually dislodges the RNA from the elongation complex that leads to transcription termination. By controlling the termination process of several genes, Rho regulates several physiological processes like transcription-translation coupling, riboswitch action, RNA remodelling, etc. Our study tries to find out all the genes that are under the control of Rho, either by directly undergoing Rho-dependent termination or indirectly via some unknown mechanism. Rho, since it is a transcription termination factor, it acts somewhat as a master regulator of transcription. Thus a defect in Rho may bring various physiological changes in the cell. In order to investigate the changes, microarray profile of four transcription termination defective Rho mutants (G51V, N340S, G324D, P279S), along with rho inhibitors like Psu and bicyclomycin treated cells were generated and analysed for E. coli K12 MG1655 strain. Separate list of up-regulated and down-regulated genes were made. Their gene ontology and pathway analysis were done using DAVID tool. The individual genes were then experimentally validated by measuring the expression level of each gene in each of these mutants in comparison to the wild type or untreated. After experimental validation, a list of up-regulated and down-regulated genes were made and their interactions were analysed to form a complete picture of Rho functions.

Keywords: transcription termination, rho, microarray

Abbreviations

Abbreviations
Abbreviations Full Form
NTD N- Terminal Domain
CTD C-Terminal Domain
PBS Primary Binding Site
SBS Secondary Binding Site
EC Elongation Complex
Psu Polarity suppressor
NCBI National Centre for Biotechnology Information
RNAP RNA(Ribonucleic Acid) Polymerase
WT Wild Type
Tet Tetracycline
Spec Spectinomycin
Kan Kanamycin
LB Luria Bertini
OD Optical Density
rpm Revolutions per minute
CaCl2 Calcium Chloride
dNTP Deoxynucleotide triphosphate
µL Micro litre
µg Micro gram
ᵒC Degree Celcius
mM Millli molar
mL Milli litre
M Molar
RT Reverse Transcription

INTRODUCTION

Background

Rho is a homo-hexameric protein (419 amino acids) that has ATPase, helicase as well as RNA binding activity. The NTD has the PBS (22-116 amino acids) that binds to the rut site on RNA and the CTD has, P loop (179-183 amino acids) for ATP binding and ATPase activity, Q loop (278-290 amino acids) and R loop (322-326 amino acids) that form the SBS.

https://s3-us-west-2.amazonaws.com/assets.authorcafe.com/9288/assets/docxassets/diagrams_final_5d433b2b07fe3/media/image1.jpeg
    A. Rho in hexameric form  B. Rho in monomeric form showing primary and secondary binding site
    https://s3-us-west-2.amazonaws.com/assets.authorcafe.com/9288/assets/docxassets/diagrams_final_5d433b2b07fe3/media/image2.jpeg
    • 1
    Rho monomer showing N340S (in red)

    Rho-dependent termination

    The classical model of Rho-dependent termination involves first, the loading of Rho onto the rut site via its PBS as an open ring structure followed by formation of closed complex upon binding to the SBS, translocation of Rho along the mRNA towards the EC via its ATPase activity, and disruption of RNA:DNA hybrid by its helicase activity.

    Rho inhibitors

    Psu- It is a phage derived Rho inhibitor, alpha helical V-shaped knotted dimer that directly interacts with Rho by blocking the exit of the RNA after binding to the SBS.

    Bicyclomycin- It is a Rho-specific antibiotic that functions by disrupting its ATPase and translocase activity by binding very close to the ATPase domain and the SBS, thereby inhibiting the hexamer ring closure step.

    Escherichia coli. K12 substr. MG1655∆rac

    The E.coli. K12 substr. MG1655 strain contains rac prophage that contains a gene called kil, whose product causes lethality to the cells. Rho- dependent termination occurs inside the racR gene to suppress the expression of the downstream kil gene expression. Deletion of rac gene prevents the cell death of rho mutated cells.

    Systems Biology

    It is the study of biological systems as a whole. It has a bottom up approach that involves detailed study of individual components that make up the system and how these components interact with each other.

    Rho, by controlling the expression of several genes also regulates several physiological processes. So a defect in Rho may bring various physiological changes in the cell. Our project aims to find out genes whose expression are under the control of Rho. For this, microarray profile of several Rho mutants and Rho inhibitor treated cells were analysed and a separate list of up regulated and down regulated genes were made. By analysing their gene ontology and pathway and experimentally validating them, we can form a complete picture of Rho functions. This can help us understand many physiological functions of Rho, making them a potential drug target.

    DAVID tool

    DAVID stands for Database for Annotation, Visualisation and Integrated Discovery. It provides a comprehensive set of functional annotation tool for investigators to understand the biological meaning of the large list of genes.

    Objectives of the Research

    The main objective of our project is to establish the overall control of Rho on cellular processes. For this, the genes under the control of Rho are to be known first. Then the interactions amongst themselves can help us know how they control some of the physiological processes of the cell.

    Overall objective

    (a) To find out the genes/operons those are directly or indirectly under the regulation of Rho.

    (b) Gene ontology terms and pathway analysis of these genes and to explore the network of interacting genes.

    LITERATURE REVIEW

    The Rho protein was discovered by J. W. Roberts in 1969.it is a homo hexamer with each protomer of 4.6kDa. This homo hexameric form is found to be the principal state in the presence of the cofactor ATP, which can exist as closed or open complex form. In recent years, several models of Rho- dependent termination have been proposed to understand its mechanism of action. According to classical view, the mechanism of Rho- dependent termination may be broadly classified into three core events: Rho loading onto the rut site (open complex); Rho translocation on RNA (closed complex); catching up to the RNAP; and eventually release of the RNA transcript by disrupting the RNA-DNA hybrid.

    Two alternative models of Rho- dependent termination are :- RNA dependent pathway, where kinetic coupling between transcribing RNAP and a translocating Rho occurs. The competing rates of translocating Rho and elongating RNAP decide the occurrence of the termination event. The kinetic coupling model has been challenged by the in vivo observation of association of Rho with the EC from the beginning of transcription, even before the formation of the transcript. This lead to the formation of the second model i.e. the RNAP dependent pathway. According to this, Rho makes transient and specific contact with the RNA exit channel and thereby induces conformational changes in the EC required for the termination to occur.

    Genomic analyses such as microarrays, ChIP-Seq, and proteomics assays (Cardinal et al., 2008; Mooney et al., 2009; Peters et al., 2012; Shashni et al., 2014) have revealed that the expression of about one-third of the operons in the log phase of E.coli are suppressed by the Rho- dependent termination. The degenerated binding sites on RNA has enabled Rho to control many cellular events like repression of unwanted genes, RNA remodelling, maintenance of chromosomal integrity, etc. The genome wide presence of Rho could soon establish it as a master regulator of many physiological processes.

    METHODOLOGY

    Microarray data analysis

    Microarray profile of four transcription termination defective Rho mutants (G51V, N340S, G324D, P279S), along with Rho inhibitors like Psu and Bicyclomycin treated cells were analysed for E. coli K12 MG1655∆rac strain. A separate list of up regulated and down regulated genes were made for all these six cases considered. The minimum fold change was taken 2 fold and the p-value was taken to be less than 0.05. The coordinates whose genes were not known were found out on NCBI. From the separate list that is made, a gene list was prepared in the format of one space between two adjacent genes in a word document.

    Use of DAVID tool for gene ontology and pathway analysis study of down regulated genes in each of the cases

    The gene list thus made was then pasted (without the accession) into the DAVID gene ID conversion tool. The corresponding gene identifier type was chosen. After submitting, it shows the converted gene IDs, along with the species name and gene names of the converted gene IDs. The option showing submit converted gene list to DAVID was clicked, in order to use those genes in one of the DAVID tools. We used the Functional Annotation tool to analyse the gene ontology, pathways, protein domains and the interactions of the genes with the other genes in the cell. The annotation source i.e. the databases in each of the annotation categories was also selected. The parameters we used during the Functional Annotation chart analysis were- Count threshold, which represents the minimum number of genes for the corresponding term, that was set for 2, which means that we do not trust the term only having one gene involved. The EASE score was set at 0.05.

    Preparation of common gene list for up and down regulation

    From the six gene lists prepared, a common gene list was also made for both up and down regulated genes. Subdivisions in each list was made according to the number of cases where a particular gene was undergoing more than 2 fold up or down regulation. For example, genes that were commonly down regulated in all the 6 cases were put into one group, those for 5 cases were put into another group and so on.

    Strain Preparation

    To experimentally validate the down regulated genes we had to first prepare the strains from which we can isolate the RNA in order to know the expression level of a particular gene in Wild type and mutant. The strain we used was E. coli MG1655∆rac. The mutant we used was N340S Rho, a secondary binding site mutant that is defective for transcription termination as it lacks ATPase activity.

    Revival streak of glycerol stock cells

    E. coli MG1655∆rac cells from glycerol stock was streaked on LB agar plate containing Tetracycline antibiotic. The E. coli DH5α cells containing Wild type and N340S Rho plasmid was also streaked on LB agar containing Spectinomycin antibiotic. All the three plates were incubated overnight at 37ᵒC.

    Competent cell preparation

    For this, a single colony of MG1655∆rac was picked up and inoculated in 10mL LB broth for 4- 5 hours in shaking until the OD reached 0.3 to 0.4. The culture was then centrifuged at 4000 rpm at 20ᵒC for 10 minutes. The supernatant was decanted and the pellet was resuspended in 10mL of chilled 0.1M CaCl2 and incubated on ice for 30 minutes. Centrifugation was done at 4000 rpm at 4ᵒC for 10 minutes. The supernatant was decanted and the pellet was resuspended in 1mL of 0.1M CaCl2 and aliquoted 100µL each. The aliquots were stored at -80ᵒC.

    Plasmid isolation from E. coli DH5α strain containing wild type and N340S plasmid by MN miniprep kit

    A single colony each from the Wild type and N340S plasmid containing cells was picked up and inoculated in 10mL LB broth overnight. 5mL of the saturated culture was taken and centrifuged 4000 rpm at 4ᵒC for 10 minutes. The supernatant was decanted. 250µL of A1 Buffer was added to it and the pellet was resuspended by vortexing and pipetting it up and down so that no cell clumps remain. The solution was then transferred to 1.5mL centrifuge tubes. 250µL of A2 Buffer was added to it and mixed gently by inverting the tube 6-8 times and incubated at room temperature for 5-10 minutes until lysate appeared clear. Then 300µL of A3 buffer was added and mixed gently by inverting the tube 6-8 times until the blue sample turned colourless completely. Centrifugation was done at 13000 rpm at room temperature for 10 minutes and the supernatant was collected in a separate centrifuge tube. Nucleospin plasmid column was taken and placed in a collection tube. Around 750µL of the supernatant was pipetted into it and centrifuged at 13000 rpm at room temperature for 1 minute. The flowthrough was discarded and the process was repeated for the remaining supernatant. 600µL of A4 buffer was added and centrifuged 13000 rpm for 1 minute, flowthrough discarded. Dry spin was done at 13000 rpm for 2 minutes and the collection tube was discarded. The plasmid column was placed in a 1.5mL centrifuge tube and 30 µL of warm wate r (65ᵒC) was added to the centre of the plasmid column and incubated at room temperature for 10 minutes. Centrifugation was done at 13000 rpm for 1 minute, the eluent was collected and the plasmid DNA concentration was measured in the Nanodrop.

    Transformation of MG1655∆rac cells with Wild type and N340S plasmid

    Three centrifuge tubes containing competent cells were taken from -80ᵒC and thawed on ice. 50ng of plasmid was added in each, one for wild type rho and another for N340S rho, and another control was taken where no plasmid was added. It was kept on ice for 20 minutes. Heat shock was given at 42ᵒC for 90 seconds and incubated immediately on ice for 10 minutes. 1mL of LB was added to each tube and incubated at 37ᵒC for 1 hour in shaking (for expression of the antibiotic gene). Centrifugation done at 4000 rpm for 7 minutes. The supernatant was discarded and the pellet resuspended in the remaining LB (~100µL) and plated on LB agar Tet -Spec plates. Plates incubated at 37ᵒC overnight. So two separate transformations done, one for Wild type rho and another for N340S rho.

    P1 transduction to delete genomic rho

    The transformed cells were streaked on LB agar Tet-Spec plates and incubated overnight. Next day, a single colony was picked up and inoculated in 4mL LB both with 10µL CaCl2 added (2.5mM i.e. 2.5µL in 1mL LB) and kept for 12 hours. The culture was aliquoted 1mL each in 1.5mL centrifuge tubes. 250µL of lysate taken and to it 83.34µL of chloroform (1/3 the volume of lysate) was added, and centrifuged at 13000 rpm at room temperature for 5 minutes. The upper layer was collected. To the 1mL culture, 100µL of the lysate was added and incubated at 37ᵒC for 20 minutes without shaking. Centrifugation done at 4000 rpm for 5 minutes and the supernatant decanted completely. 100µL of 1M Sodium citrate was added to each tube and the pellet was resuspended. 1mL of LB was added and incubated at 37ᵒC for 45 minutes with shaking (for expression of the antibiotic). Centrifugation done at 4000 rpm for 5 minutes, supernatant discarded, pellet resuspended in 100µL of Citrate buffer. The suspension was plated on LB agar Spec Kan plates and incubated at 37ᵒC overnight. The transduced cells were then streaked to purify the colonies.

    Colony PCR to determine the presence of the inserted Kanamycin gene

    A 15µL reaction mixture was set up using the following components and conditions. All the components except the template was mixed to make a master mix and 14µL was aliquoted in each PCR tube and template (the culture) was added to each tube. 8 colonies from wild type rho and 8 from N340S rho was taken, a positive control taken with a known plasmid containing Kanamycin gene and a negative control containing no template, so a total of 18 reactions were set up.

    Components and their concentrations or volumes used for colony PCR
    Components Volume(in µL) per reaction
    Dream Taq Buffer(10X) 1.5
    dNTPs(10mM) 0.5
    Forward Primer(10pm/µL) 0.5
    Reverse Primer(10pm/µL) 0.5
    Template 2
    Dream Taq Enzyme(5U/µL) 0.15
    Water 9.85

    Conditions used in PCR (30 cycles)
    Step Temperature Time
    Initial denaturation 95ᵒC 5 minutes
    Denaturation 95ᵒC 30 seconds
    Annealing 55ᵒC 40 seconds
    Extension 72ᵒC 30 seconds
    Final extension 72ᵒC 5 minute
    Hold 4ᵒC

    Agarose gel electrophoresis: - After PCR amplification, the PCR product was run on 1% agarose gel with a 1kb plus ladder. For preparing gel, 1gm of agarose was mixed with 100mL of 1X TAE and 3.5µL of goodview (fluorescent dye to visualize DNA) was added to it. The gel was poured into gel plate to solidify the agarose. 1X TAE buffer was used as a running buffer. 1.7µL of loading dye was put into the PCR product and was run on the gel at 110V for 30 minutes. The gel was then observed under UV light in the geldoc.

    RT PCR to determine the expression level of Selected Genes

    In order to determine the expression level of certain genes, RNA from wild type rho cells and N340Srho cells were isolated and RT PCR was done and a comparison was made between the two.

    Primer designing of selected genes on NCBI Primer3 tool

    At the NCBI Primer3 tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/), the FASTA sequence of the gene whose primer we want to design was pasted from NCBI. The forward primer range was set from the beginning of the gene i.e. from the first nucleotide to the nucleotide at the middle of the gene and the reverse primer range was set from the nucleotide next to the middle one to the last nucleotide. In the primer parameters section, PCR product size was set from 150 to 250. At the primer pair specificity checking section, the database selected was Refseq representative genomes and the organism chosen was Escherichia coli. K12 substr. MG1655. After submitting, a list of primers appeared from which we had to select primers having the following characters: -

    a. Melting temperature at 60C

    b. Difference in melting temperature between the two primers less than 2C

    c. Length of primers 20 nucleotides

    d. Self complementarity value maximum 4

    e. 3’self complementarity maximum 3

    f. GC content maximum 50%

    Culture set of selected colonies

    3 colonies were picked up each from WT and N340S plate and inoculated separately in 3mL LB containing Spectinomycin and Kanamycin antibiotic overnight at 37C in shaking. From the primary culture thus formed, 1% secondary culture was set up in duplicates in 4mL LB containing Spec and Kan and incubated at 37C for 4-5 hours until the OD reaches between 0.3 to 0.4.

    RNA isolation from Wild type Rho and N340S Rho containing cells by RNA Easy Plus Qiagen kit

    The culture thus formed was centrifuged at 11000 rpm for 3 minutes. The supernatant decanted and to the pellet, 150µL of lysozyme in DEPC water (10mg/mL) was added to resuspend the pellet. It was incubated in ice for 5 minutes. 500µL of Trizol was added and mixed properly by vortexing. 200µL of Chloroform was added, mixed, kept at room temperature for 5 minutes and then centrifuged at 12000 rpm at 4C for 25 minutes. The aqueous phase was taken carefully and 700µL of RLT Buffer was added to it and mixed. The solution was passed through genomic DNA eliminator column and centrifuged at 12000 rpm at 4C for 1 minute, flowthrough collected and kept at room temperature. 300µL of absolute ethanol was added and again kept at room temperature. The solution was added to RNA Easy Column and centrifuged at 12000 rpm for 1 minute, flowthrough discarded. 700µL of RW1 added and centrifuged at 12000 rpm for 1 minute. Washing done with 500µL of RPE twice and empty spin in 1.5mL centrifuge tube. Elution done with 25µL of water(at 65C) twice. The Nanodrop reading of the RNA was taken.

    Agarose gel electrophoresis was done to check the RNA integrity. 1% agarose gel made and 1000ng of RNA was loaded for each.

    The RNA was aliquoted 6µL each and stored at -80C.

    DNase treatment to remove genomic DNA

    A 10µL of reaction mixture was set up containing 1.5µg of RNA, 1µL of DNase, 1µL of DNase Buffer and rest of water. It was incubated at 25C for 15minutes. 1µL of 25mM EDTA was added and incubated at 65C for 10 minutes, followed by on ice for 5 minutes. RNA concentration was measured on Nanodrop.

    PCR was set up to confirm the removal of genomic DNA. For this, constitutively expressed rpoc gene primer was used to see whether amplification occurs or not. The following components were used.

    Components and their concentrations and volumes for PCR
    Component Volume(in µL) per reaction
    Dream Taq Buffer(10X) 1
    DNTPs(10mM) 0.5
    Primers(5pm/µL) 0.5
    Template 1
    Dream Taq(5U/µL) 0.1
    Water 6.9
    Conditions used in PCR (30 cycles)
    Step Temperature Time
    Initial denaturation 95ᵒC 5 minutes
    Denaturation 95ᵒC 30 seconds
    Annealing 55ᵒC 40 seconds
    Extension 72ᵒC 30 seconds
    Final extension 72ᵒC 1 minute
    Hold 4ᵒC

    Agarose gel electrophoresis was done in 2% agarose.

    cDNA synthesis

    From the RNA that was purified, cDNA synthesis was done in two steps.

    For cDNA synthesis I, a reaction mixture of 6.5µL was used comprising the following components

    Components and their amount used in cDNA synthesis I per reaction mixture
    Components Amount
    RNA 1µg
    dNTPs 1µL
    Random hexamers 0.5µL
    Water Rest of the volume

    It was incubated at 65C for 5 minutes and immediately in ice for another 5 minutes.

    For cDNA synthesis II, a 3.5µL reaction mixture was set up having the following components

    Components and their volume for cDNA synthesis II
    Components Volume(in µL) per reaction
    Buffer(5X) 2
    DTT(0.1M) 0.5
    RNase out 0.5
    SS III RT 0.5

    3.5µL of cDNA synthesis II mixture was added to 6.5µL of each cDNA synthesis II mixture to make up a total volume of 10µL. It was then run on PCR under the following conditions.

    Conditions used during cDNA synthesis II
    Temperature Time(in minutes)
    25ᵒC 10
    50ᵒC 50
    85ᵒC 5
    4ᵒC

    After cDNA synthesis, several dilutions were made like of ½, 1/10, 1/15 and 1/20. A 10µL PCR was set up to check for successful cDNA synthesis using rpoc gene primers. The following components were used

    Components and their amount for PCR (1/15 dilution)
    Components Volume(in µL) per reaction
    Dream Taq Buffer(10X) 1
    dNTPs(10mM) 0.5
    Primer 0.5
    Template 1
    BSA 0.1
    Dream Taq (5U/µL) 0.1
    Water 6.8

    The conditions used for PCR is the same as used for rpoc synthesis after DNase treatment.

    Agarose gel electrophoresis was done in 2% agarose.

    Down regulated gene check

    4 genes were checked for down regulation, that are, osmE, narG, narH, and csrB, along with rpoc taken as standard, for both wild type rho and N340S rho cells. The sets used were W2 and N1 in 1/15 dilution. Reaction volume made was 10µL containing the same components as done for rpoc just before. The conditions used were also the same. The number of cycles taken was 30X for one set and 35X for the other set.

    Agarose gel electrophoresis was done in 1.5% agarose to compare the amplification between Wild type rho and N340S rho containing cells.

    RESULTS AND DISCUSSION

    Microarray Data Analysis

    Gene ontology and pathway analysis on DAVID tool

    Pathway analysis of up-regulated genes
    Pathway Number of genes involved p-value
    Thiamine metabolism 7 0.010
    Selenocompound metabolism 8 0.019
    Bacterial chemotaxis 8 0.047
    Pathway analysis of down-regulated genes
    Pathway Number of genes involved p-value
    Glycine, Serine, Threonine metabolism 9 5.62E
    Biosynthesis of secondary metabolites 29 0.006
    Glyoxylate and dicarboxyglyoxylate metabolism 8 0.010
    Carbon metabolism 13 0.026
    Glycolysis and gluconeogenesis 7 0.032

    List of commonly down regulated genes

    Down-regulated genes in any of the four cases with 2-fold cut-off
    Gene G51V N340S G324D P279S PSU BCM
    treB -3.699 -1.6385 -1.9169 -2.997 -3.089 -2.35
    asnA -2.526 -1.8250 -2.2700 -2.217 -1.815 -3.18
    katG -2.285 -0.8510 -3.9526 -2.367 -1.828 -2.68
    mgsA -1.989 -2.7458 -2.9938 -2.548 -1.667 -2.03
    Down-regulated genes in any of the three cases with 2-fold cut-off
    Gene G51V N340S G324D P279S PSU BCM
    adhE -1.526 -0.0943 -2.6888 -1.716 -2.322 -2.07
    pflB -0.583 -0.4829 -2.7923 -0.574 -2.189 -3.10
    sdaC -1.453 -2.6278 -0.5809 -1.453 -2.360 -2.09
    proL -0.467 -2.1968 -0.4269 -1.147 -2.426 -2.25
    zur -0.124 -1.6761 -2.5879 -0.072 -2.059 -2.07
    osmE -1.616 -2.2381 -1.5315 -2.056 -3.486 -1.46
    eco -1.127 -2.0391 -2.0269 -1.140 -2.556 -1.68
    glnA -1.127 -2.0959 -2.3086 -0.865 -3.111 -1.71
    aceA -2.132 -1.8561 -0.0453 -2.646 -2.151 -1.42
    ompF -0.942 -2.1456 -2.2196 -1.011 -2.691 -1.72
    malK -1.531 -1.8009 -2.0942 -2.044 -2.657  
    serT -3.179 -1.5314 -0.6252 -3.007 -2.894  
    narK -1.596 -3.7767 -6.8727 -1.786 -0.766 -3.98
    narG -1.040 -3.7537 -7.6887 -1.149 1.622 -3.30
    yhbS -1.879 -1.6508 -3.4893 -2.214 -0.750 -3.14
    csrB -1.918 -2.8826 -0.9963 -2.494 -3.025 -3.06
    narH -1.006 -2.1096 -8.2125 -1.369 2.234 -2.91
    dhaM -1.112 -2.0229 -2.9036 -1.116 0.316 -2.41
    Primer sequence of the 10 down-regulated genes selected
    Gene Primer sequence
    treB CTATCAGGCGCAGGTGATCC
    CCAATCATGCGACCAAACGG
    asnA GGCGGGAATTAAAGCAACCG
    ATCCCGACAAGGAATACCGC
    katG TGCCATTACCTCTGGTCTGG
    CGGTTTACGTTTCTTCGACGG
    adhE CAGCGTCTCAGGGTGGTATC
    GCCACGGCGGAAGTAGATAG
    osmE GCGGTATTAACCATGCTGGC
    TACCATCACGTTGACCCAGG
    tnaB TCATCTATCTCCGGTTCCCA
    ACCCATCTGTTCCATCACCA
    narG ATCTGACGCTGGCAAACTAC
    TTATCGGCAAATTCACGGGC
    yhbS ACGCCAACTGGTCTATGAAGG
    TGCTCGTGATACTCAACCAGG
    csrB ATGGTGTTTCAGGGAAAGGC
    ACTATTGCTTCCTGCTCACAC
    narH ATGGCATCGTCCTGATCGAC
    AACGGATACGACCGACACAG

    Strain Preparation

    default
      Transformed colonies of MG1655∆rac WT rho
      https://s3-us-west-2.amazonaws.com/assets.authorcafe.com/9288/assets/docxassets/diagrams_final_5d432b7490134/media/image2.jpeg
        Transformed colonies of MG1655∆rac N340S rho
        default
          Transduction of MG1655∆rac, ∆rho::kanR, WT rho and MG1655∆rac, ∆rho::kanR, N340S rho.

          N340S mutant colonies are defective for growth as compared to the wild-type colonies as they lack the ATPase activity required for the translocation of Rho along the RNA. This leads to the expression of some lethal genes leading to growth deficiency.

          RNA Isolation

          default
          • 1
          • 2
          • 3
          • 4
          • 5
          • 6
          • 7
          Agarose gel run for RNA integrity check.

          Clear bands obtained for 16S rRNA and 23S rRNA indicating stable RNA integrity.

          Concentration of RNA in the isolated RNA for Wild type (W) and N340S (N)
          SampleConcentration(in ng/µL)
          W11990.4
          W21983.0
          W32797.9
          N11834.0
          N21021.3
          N31884.4
          default
          • 1
          • 2
          • 3
          • 4
          • 5
          • 6
          • 7
          Gel electrophoresis of rpoc gene amplification to confirm successful DNase treatment.

          No bands obtained for rpoc gene indicating the absence of genomic DNA.

          cDNA Synthesis

          default
          • 1
          • 2
          • 3
          • 4
          • 5
          • 6
          • 7
          • 8
          • 9
          Gel electrophoresis of rpoc gene amplification from cDNA template run for different temperatures and different cycles. 
          https://s3-us-west-2.amazonaws.com/assets.authorcafe.com/9288/assets/docxassets/diagrams_final_5d432b7490134/media/image7.jpeg
          • 1
          • 2
          • 3
          • 4
          • 5
          • 6
          • 7
          • 8
          • 9
          • 10
          • 11
          Gel electrophoresis showing comparison of expression level between Wild type and N340S Rho mutant
          default
            Graph showing fold change comparison between Wild-type and N340S Rho mutant.

            For the gene osmE, the expression level of N340S rho mutant is slightly less than that of the Wild type, whereas in the csrB, the expression level in both the cases are same. For the rest of the two genes taken, no clear bands were observed.

            CONCLUSION

            From the microarray data, analysed 3961 genes were analysed for Rho mutants of which 1119 genes were found to be up regulated and 201 were found to be down regulated; 2995 genes were analysed for the Psu treated cells of which 876 were found to be up regulated and 117 were down regulated, and for the 2319 Bicyclomycin treated cells analysed, 446 were up- regulated and 118 were down regulated. The fold threshold for up and down regulation was taken to be 2.

            From the pathway analysis done for the common genes for Rho-mutants and Psu treated cells three common pathways were affected for the up regulated genes and five pathways were found to be affected for the down regulated genes.

            For the down regulated genes considered, 4 genes (treB, asnA, katG, mgsA) were found to be common in four of the six cases considered, and 18 genes (adhE, pflB, sdaC, proL, zur, osmE, eco, glnA, aceA, ompF, malK, serT, nark, narG, vhbS, csrB, narH, dhaM) were common in three of the cases. Of these ten genes were taken for experimental validation that are, treB, asnA, katG, adhE, psmE, tnaB, narG, yhbS, csrB, narH.

            When four of the genes that are, osmE, narG, narH and csrB were analysed first by RT PCR, only osmE showed slight less amplification and fold change than the Wild type. The other three genes did not show any noticeable amplification.

            REFERENCES

            Banerjee S, Chalissery J, Bandey I and Sen R (2006) Rho- dependent transcription termination. More questions than answers J Microbiol 44 11-22

            Borukhov S, Lee J and Laptenko O (2005) Bacterial transcription elongation factors: new insights into molecular mechanism of action Molecular Microbiology 55 1315-24

            Cardinale C J, Washburn R S, Tadigotla V R, Lewis M B, Gottesman M E and Nudler E (2008) Termination factor Rho and its cofactors NusA and NusG silence foreign DNA in E. coli Science 320 935-38

            Chalissery J, Banerjee S, Bandey I and Sen R (2007) Transcription termination defective mutants of Rho: role of different functions of Rho in releasing RNA frok the elongation complex J MolBiol 371 855-72

            Dutta D, Chalissery J and Sen R (2008) Transcription termination factor Rho prefers catalytically active elongation complexes for releasing RNA J Biol Chem 283 20243-51

            Mitra P, Ghosh G, Hafeezunnisa and Sen R(2017) Rho protein: roles and mechanisms Annu Rev Microbiol 71 687-709

            Peters J M, Vangeloff A D and Landick R (2011) Bacterial transcription terminators: The RNA 3’- end chronicles J Mol Bio 412 793-813

            Peters J M, Mooney R A, Kuan P F, Rowland J L, Keles S and Landick R (2009) Rho directs widespread termination of intragenic and stable RNA transcription Proc Natl Acad Sci USA 106 15406-11

            Shashni R, Qayyum M Z, Vishalini V, Dey Debasish and Sen R (2014) Redundancy of primary RNA- binding functions of the bacterial transcription terminator Rho Nucleic Acids Res 42 9677-90

            Skordalakes E and Berger J M (2003) Structure of the Rho transcription terminator: mechanism of mRNA recognition and helicase loading Cell 114 135-46

            Passong Immanuel R. Chhakchhuak, Ajay Khatri, Ranjan Sen, 2018, Mechanism of Action of Bacterial Transcription Terminator Rho, Proceedings of the Indian National Science Academy 85 157-168

            ACKNOWLEDGEMENTS

            First I would like to acknowledge science academies (IASc/INSA) for providing me this opportunity under Summer Research Fellowship Program 2019.

            I would like to express mt heartiest gratitude to Dr. Ranjan Sen, Staff Scientist, CDFD, Hyderabad, for guiding me through this project. It has been a very good experience to work with him. I thank him for providing a motivating and enthusiastic atmosphere during the period of my work.

            I gratefully acknowledge my mentor Dr. Amit Kumar and Passong Immanual R C, for their constant support, advice, help critical review, scientific guidance and encouragement.

            I am grateful to Dr. Sanjeev Khosla, Dean, CDFD, for providing me accommodation at CDFD hostel.

            I acknowledge Professor Rajnikant Mishra, Department of Zoology, Institute of Science, Banaras Hindu University, Varanasi, for providing my letter of recommendation to Indian Academy of Sciences.

            I am grateful to my parents and sisters for their unconditional love and support.

            I would like to thank all the lab members for their help, support and advice.

            References

            • Pallabi Mitra, Gairika Ghosh, Md. Hafeezunnisa, Ranjan Sen, 2017, Rho Protein: Roles and Mechanisms, Annual Review of Microbiology, vol. 71, no. 1, pp. 687-709

            • Passong Immanuel R. Chhakchhuak, Ajay Khatri, Ranjan Sen, 2018, Mechanism of Action of Bacterial Transcription Terminator Rho, Proceedings of the Indian National Science Academy, vol. 84, no. 0

            Source

            • Fig 1: Protein Data Bank ID 3ICE
            • Fig 2: Protein Data Bank ID 3ICE
            More
            Written, reviewed, revised, proofed and published with