Loading...

Summer Research Fellowship Programme of India's Science Academies

Generation of M. smegmatis allelic exchange substrates of ribosomal factors

Diksha Chaturvedi

Guru Gobind Singh Indraprastha University, Sector 16 C, Dwarka, Delhi 110078

Vinay K. Nandicoori, Ph.D

Scientist, Signal Transduction Lab I, National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi 110067

Abstract

Tuberculosis is one of the world’s deadliest diseases that causes over a million deaths around the world every year. Due to the complexity in biology of its etiological agent, Mycobacterium tuberculosis (Mtb), and evolution of multi drug resistant strains, it still remains a challenge. Ribosome maturation and assembly is one of the most conserved processes, which is essential for bacterial survival. Multiple sites on ribosomes and protein synthesis are in fact, a target for many antibacterial drugs. Here, we set out to understand the role of four genes namely, smeg_4493 (era), smeg_1889 (rsgA), smeg_5438 (ksgA) and smeg_2629 (rbfA) which participate in different stages of ribosome assembly into the subunit and maturation of complete 70S in mycobacteria. era and rsgA encodes for GTPases, principal regulators of ribosome function; ksgA encodes dimethyladenosinetransferase and confers kasugamycin resistance to Mtb; rbfA encodes for a putative ribosomal binding factor and thus, needed for efficient 16SrRNA processing. In order to evaluate their functions, it is necessary to generate gene replacement mutants, which can then be used for functional experiments. To generate mutants, we used recombineering technique, which utilizes double homologous recombination. This requires presence of Allelic Exchange Substrates (AES), where upstream and downstream regions of the target gene are cloned with an antibiotic marker between them. In this project, four AES constructs had been generated that can be used for generating gene replacement mutants of the era, rsgA, ksgA and rbfA.

Keywords: antibacterial drugs, GTPase, gene replacement mutants, recombineering, double homologous recombination, antibiotic marker

Abbreviations

Abbreviations
µl Microlitre
µM Micromolar
AMQ Autoclaved MilliQ
ATP Adenosine Triphosphate
BCG Bacillus Calmette–Guérin
bp Base pair
CTAB Cetyltrimethylammonium bromide
DMSO Dimethyl sulfoxide
DNA Deoxyribonucleic acid
dNTP Deoxyribonucleotide triphosphate
EDTA Ethylene DiamineTetraacetic Acid
EtBr Ethidium Bromide
GC Guanine-cytosine
GTP Guanine Tri-phosphate
HIV/AIDS Human Immunodeficiency Virus/ Aquired Immune Deficiency Syndrome
kb Kilo basepair
LB Luria Broth
M Molar
ml Millilitre
mm Millimetre
mM Millimolar
N Normal
N₂ Nitrogen
O.D Optical Density
PBS Phosphate-buffered saline
PCR Polymerase Chain Reaction
pgm Picogram
pH Power of hydrogen
PNK Polynucleotide kinase
psi Pound per square inch
rpm Revolutions per minute
rRNA Ribosomal Ribonucleic acid
S Svedberg unit
SDS Sodium dodecyl sulfate
SOB Super Optimal Broth
SOC Super Optimal Broth with Catabolite repression
TAE Tris-acetate EDTA
TE Tris-EDTA
UV Ultravoilet
WHO World Health Organisation

INTRODUCTION

Background/Rationale

Tuberculosis (TB) is one of the leading deadliest diseases in the world today that cause over a million deaths around the world every year and is an infectious disease with least survival rate. TB has infected around one-fourth of the world’s population and currently, is the major killer among people having HIV/AIDS. Recently, India is taking the highest TB burden followed by Indonesia, China, Philippines, Pakistan, Nigeria and South Africa, where they all are sharing 64% of the global TB burden [1].

Tuberculosis is caused by Mycobacterium tuberculosis (Mtb), a severely pathogenic organism having human as a host. Mtb has a doubling time of around 15-20 hours and it can take weeks for its colonies to become visible on agar plates. Due to this slow growing feature of Mtb, it is a cumbersome process to study Mtb in laboratory. Mtb has a distinctive cell wall which is essential for its virulence. Composing mainly of mycolic acids and lipids, cell wall of Mtb also constitutes arabinogalactan and peptidoglycan with an impermeable thick waxy outer coating and innermost lipid bilayer. Presence of mycolic acids in the cell wall is the major factor in view of this bacterium’s survival and pathogenicity and provides several advantages such as resistance to drugs and other toxic substances [2].

Tuberculosis mainly affects the lungs and is spread from one person to another through aerosols that are generated during sneezing and coughing by an infected person. Initially, the bacilli get phagocytosed by alveolar macrophages, followed by apoptosis of the infected macrophages, eventually leading to exponential bacilli replication. This leads to formation of lesions in the tissue known as granuloma, hallmark of tuberculosis [3].

From the advent of researches, BCG has remained the highly effective vaccine for the prevention of Tuberculosis, and is used till date to vaccinate children especially in TB vulnerable areas. TB patients require completing a long duration treatment with a number of doses of antibiotics in order to successfully overcome the disease. But because of irregularities and the pathogen’s ability, Mtb can again become active and can become resistant to some of the drugs or antibiotics, which makes the treatment even more difficult [2]. In Mtb, the drug resistance is majorly found towards most common treatments, isoniazid and rifampicin [4]. The emergence of this increasing resistance in Mtb towards multiple drugs is therefore, creating a havoc condition nowadays and making TB, a never ending disease.

Various efforts are being continuously made towards finding an effective and safe treatment for tuberculosis. But due to the complex biology of Mtb and need for higher biosafety levels, it is challenging to study Mtb on every aspects. Mycobacterium smegmatis (Msm) has been found to have several similar features to that of Mtb especially homology with many of its genes and nearly, similar cell wall nature and in addition to it, have short generation time and is non-pathogenic in nature, and therefore, acts as a model organism for structural and functional studies in other mycobacteria in most cases. Msm is widely used in studying biology of Mtb and mechanisms responsible for its pathogenicity. It has also contributed in explaining the functioning of some secretion systems in Mtb virulence ​[5]​.

Genetic studies help in understanding the mechanisms and specific molecules involved in any particular pathway of an organism and provides us an opportunity to reach at the origin of cause, which seems difficult and often time-consuming by other methods of investigating organisms, and since, genetic studies can’t be imagined without developing gene knockouts, therefore, to study Mtb or Msm, various gene knockout methods are being employed for developing mutants. One such method, recombineering worked quite successfully in mycobacteria, which is a recently developed genetic engineering method based on homologous recombination with phage-encoded recombination function [6].

Recombineering system was first developed in Escherichia coli (E.coli) where efficient homologous recombination is promoted by phage-encoded recombination systems. Recombineering in Mtb has initially, faced limitations due to the high rate of illegitimate recombination shown by the species and in addition, E. coli bacteriophage recombination system was found to not work properly in mycobacteria. Che9c identified by van [7] ​in 2006, is the rare mycobacteriophage that encodes recombination proteins homologous to E.coli Rac prophage and help to facilitate allelic exchange by increasing recombination frequencies in mycobacteria [8]. Recombineering proficient mycobacterial strains contain an extrachromosomal plasmid, and an inducible acetamidase promoter controls the phage recombination genes present in it i.e. che9c gp60 and gp61 which together, are used for recombineering with dsDNA substrates. Plasmid pJV53 is found to regulate expression of both gp60 and gp61 genes from its endogenous translational signals and give optimal dsDNA recombineering frequencies ​[6]​.

Recombineering method is fast and more efficient than older methods of genetic engineering and comes with several other advantages too. The major one is that, it doesn’t require the presence of accessible restriction sites on the target sequences. Also, it can engineer large constructs in ranges of kilobases and can work with very short homologies of 40-50 kb. But in contrary to it, recombineering essentially requires the genome sequence of the organism under consideration and therefore, it can’t be performed in unsequenced organisms. And with that, more efficient recombination systems and ways of increasing recombination frequency in mycobacteria, are still the subject of research for scientists.

dsDNA recombineering is extensively used in achieving gene replacements and is also commonly employed for carrying out deletions, alterations and insertions of gene sequences and also adding tags into the gene of interests [9]. For studies on Mtb, gene replacement mutants are generated, where target genes get replaced by an antibiotic resistance gene by homologous recombination. For creating such gene replacements in the genome, allelic exchange substrates are constructed which after linearizing, electroporated into the host, Mtb or Msm with gp60 and gp61 genes induced by pJV53 plasmid. Once inside the cell, through homologous recombination, the substrate replaces the target gene. After that, antibiotic resistant colonies are screened for positive recombinants ​[6]​.

Allelic exchange substrate (AES) is a circular gene replacement substrate which utilizes the recombination machinery in the host organism to replace the gene of interest with a mutant gene, usually an antibiotic resistance cassette by homologous recombination. AES essentially involves an antibiotic resistance gene which must have its flanks homologous to the flanking region of the target gene and oriE (origin of replication) + cosλ region, which is utilized in its cloning outside the host. Recombineering requires the introduction of linear allelic exchange substrates into the host, which is achieved by removing oriE + cosλ region from the circular vector by digesting with an appropriate restriction endonuclease.

Other than creating single gene replacements, AESs can also add γδ res sites present upstream and downstream to antibiotic resistance gene to order to unmark mutants and sacB for counter selection ​[6]​.

AES.png
    Overview of recombineering process

    Ribosomes assist in protein synthesis in all living cells, which is an essential process required for several vital functions that include maintaining cell structure, repairing damage etc. Ribosomes are found to comprise nearly half of dry weight of the cells. Its maturation and assembly into the subunit is one of the most conserved processes in all living cells, and is very essential for the survival. While being conserved in function, ribosomal machinery is mainly composed of proteins and rRNAs, where the latter has different types in prokaryotic 70S (23, 16 and 5S rRNA) and eukaryotic cells 80S (28S rRNA, 18S rRNA and 5S rRNA) ribosomes. Due to having such structural differences in both types of cells, it is an attractive target of most antibacterial drugs while not harming eukaryotes. Major antibacterial drugs works by inhibiting the protein synthesis by targeting ribosomal subunits where either tRNAs binding and translocation is prevented or binding of aminoacylated-tRNAs and channeling of nascent protein is prevented, and some of those drugs are macrolides family of antibiotics, chloramphenicol etc [10].

    Knocking out ribosomal genes of Mtb, thus, halting processes performed by them, can help us understand importance of those processes in bacterium’s survival, which can be subsequently employed for developing antibacterial drugs. In Msm, gene era encodes for GTP binding protein Era [11]and GTPases [12]. While GTP binding proteins involve in cellular signalling and pathogenicity in bacteria [13] and GTPases are the principle regulators of ribosome function and involved in cell cycle control [14] , role of the era in Msm is yet to discover. Gene rsgA encodes putative ribosome small subunit-dependent GTPase RsgA [15]. Originally, RsgA proteins serve in maturation of bacterial ribosome [16] and may also have role in assembly of ribosomal proteins [17]. Third gene ksgA, produces dimethyladenosinetransferase which in the conserved hairpin loop, specifically dimethylates two adjacent adenosines, close to the 3'-end of 16S rRNA in the 30S particle and confers kasugamycin resistance to Mtb [18].The rbfA gene encodes ribosome-binding factor A which is found to be necessary for efficient processing of 16S rRNA [19]. 16S rRNA in turn, encodes smaller subunit RNA component in bacterial ribosomes.

    Objectives of the Research

    Overall objective

    In order to evaluate the role of aforementioned ribosomal genes or factors in Msm, allelic exchange substrates (AESs) had been generated for each of these four genes namely MSMEG_4493 (era), MSMEG_1889 (rsgA), MSMEG_5438 (ksgA) and MSMEG_2629 (rbfA), by ligating hygromycin cassette, hygᴿ with PCR amplified 5’ and 3’ flanks that are homologous to the flanking regions of the gene of interest and oriE + cosλ region, by performing four-piece ligation of all of these fragments.

    Strains and plasmids used in this study 
    Strain or plasmidDescriptionSource
    M. smegmatis mc² 155 Genomic DNAUtilized as PCR templateM. smegmatis mc² 155
    E. coli DH5αUtilized for cloning purpose Wild type
    puc19Replicative plasmid with an ampicilin resistance gene Commercial preparation
    p004SReplicative plasmid Commercial preparation
    pENTR

    Replicative plasmid with an hygromycin cassette and can uptake any insert having cacc sequence at the beginning of one of its end.

    Commercial preparation

    LITERATURE REVIEW

    In 2006, Julia C van Kessel & Graham F Hatfull​​​​ [7]had identified a rare mycobacteriophage Che9c among 30 genomically characterized ones, which encodes for recombination proteins, gp60 and gp61, that were by sequence and domain studies, found to be homologous and functionally related to RecE and RecT proteins respectively, present in E. coli Rac prophage, whereas the latter themselves, are functional analogs of Exo and Beta proteins of λ phage respectively. Exo is 5’-3’ dsDNA-dependent exonuclease and Beta is ssDNA-binding protein that essentially promotes annealing of complementary DNA strands. Initially, in their objective to determine mycobacterial recombineering requirements, they had used AES generated from p0004S:leuD (a gift of W.R. Jacobs Jr.) containing hygᴿ gene, flanking with 1kbp sequence homologous to gene flanks of leuD gene of Msm by restricting plasmid backbone, which was then, electroporated into Msm pJV24 cells and by analysing subsequent growth pattern of colonies under presence and absence of leucine, concluded that recombination substantially enhanced by Che9c 59-62 proteins expression. It is also shown that strains with plasmids expressing both gp60 and gp61 (pJV53 and pJV63 respectively), support recombination but if either is absent, transformants recovery will not happen. In determining general recombineering utility in Msm, they examined allelic exchange of nonauxotrophic loci. For that, ~500 bp of both upstream and downstream region of the target non-essential gene (groEF1) were amplified by PCR and cloned into pYUB854 containing hygᴿ gene having γδ res sites and unique restriction sites in its flanking regions. The entire segment containing the flanking regions of groEL1 and hygᴿ was PCR amplified and purified and electroporated in Msm. Obtained 90% of the colonies were resulted from allelic exchange. Similar experiment was conducted with six more Msm loci, and observed the exact result, which has helped them to conclude that recombineering is a successful method of constructing allelic exchange mutants of Msm. The same groEF1 allelic exchange substrate was also constructed in order to determine the functioning of Che9c recombineering system in slow growing bacteria, Mtb and for that, H37Rv::pJV53 cells were transformed with the substrate after 24 hours induction. A substantial increase in recombination frequency was observed by seeing the growth of healthy colonies in the recombineering strain and after performing again a similar experiment by constructing linear substrate by cleaving near the oriE and then, transforming in Mtb H37Rv::pJV53, it was concluded that Che9c recombineering system works effectively for allelic exchange in both Mtb and Msm. Recombineering is therefore, proved to be an effective method in studying mechanisms and characteristics of Mtb and other mycobacteria​[7]​​.

    Efflux pumps are involved in passing drugs and other substances out of the cell and other than chromosomal mutations in drug targets, malfunctioning in efflux pumps can also led to development of drug-resistant strains of Mtb​ [20]. In order to clarify the role of an efflux pump, mmr, in the development of resistance to isoniazid and other drugs in Mtb, in 2012, L. Rodrigues, C. Villellas, R. Bailo, M. Viveiros, J. A. Ainsa ​[20]​ had generated two types of mutants of Mtb, one those were lacking Mmr (Rv3065) efflux pump by generating AES and other, those were overexpressing it. In their studies, they saw increased susceptibility towards some dyes such as EtBr and CTAB, in Mmr knockout mutants whereas decreased susceptibility towards acriflavine, Safranin O and EtBr in mutants overexpressing it. Also, Mmr gene confers a low-level resistance when increasingly expressed and under such conditions, bacteria have chances to get mutated and confer even high-level drug resistance. Therefore, it has been assumed that efflux inhibitors can decrease this low susceptibility problem of drugs in Mtb [21]​​[22]​.The mmr pump is found in ejection of EtBr, erythromycin, acriflavine and pyrrole class of compounds and previously, authors had observed, its overexpression under high isoniazid level, which suggests its resistance to isoniazid. For generating mmr knockout mutant, they had utilized allelic exchange method. They had used a Mtb recombineering strain, transformed with pJV53 plasmid having gp60 and gp61 proteins encoded by Che9c mycobacteriophage which was electroporated with linear DNA molecules having homologous sequences to the chromosomal DNA. Primers were designed in order to amplify flanking regions of mmr gene which were of 576 and 996 bp and then cloned into pYUB854 plasmid which had hygromycin resistance cassette on its flanking regions. The resulted vector, pMmr was digested with two enzymes namely, AvrII and HindIII and amplified by PCR to generate AES. After that, subsequent required processings were performed to attain their objective​[20]​.

    There are some limitations to allelic exchange substrates, one of which is, antibiotic marked strains that are resulted from them, whereas, involvement of counterselection cassettes can provide unmarked and scarless strains, but the latter strategy requires specific host genotype and therefore, used limitedly. Also, counter selection strategies that are background independent utilizing sacB or other are valuable but demands optimization whereas, counter selection escape strategies where AES stay remains in the genome, isolation of desired mutants becomes quite difficult, and thus imposes limitations to the concerned technique​[23]​.

    METHODOLOGY

    Preparation of Highly Efficient E. coli DH5α Competent Cells and Determination of Transformation Efficiency

    For cloning purpose, highly efficient E. coli DH5α ultra competent cells were prepared.

    Preparation of transformation buffer

    Materials required

    • mdi syringe filter with pore size 0.2 μm and diameter 25 mm, HMD DISPO VAN 20 ml syringe, Thermo Fisher Scientific pH meter, electronic weighing balance, AMQ
    Composition of transformation buffer with concentration of stock and final solution of each component
    Chemicals

    Concentrations of stock

    Solution  

    Final Concentrations
    Pipes-NaOH ( pH 6.7)0.5 M10.0 mM
    CaCl₂0.5 M15.0 mM
    KCl2.0 M0.25 mM
    MnCl₂1.0 M55.0 mM

    Procedure

    Transformation buffer was prepared by adding appropriate volumes of self-prepared above stock solutions and the final required volume was brought by adding AMQ. After that, it was filtered by using mdi syringe filter having pore size of 0.2 µm and diameter 25 mm and HMD DISPO VAN 20 ml syringe. Prepared buffer was then, stored at 4°C.

    Preparation of SOB media

    Materials required

    • Thermo Fisher Scientific pH meter, electronic weighing balance, autoclave, 5N NaOH, AMQ
    Compostion of SOB media with final concentration of each component
    ChemicalsFinal Concentrations
    Bactotryptone2.0%
    Yeast extract0.5%
    NaCl10.0 mM
    KCl2.50 mM
    MgCl₂.6H₂O10.0 mM
    MgSO₄10.0 mM

    Procedure

    SOB media was prepared by adding the above self-prepared stock solutions in appropriate volumes or amounts and were dissolved initially in minimum amount of AMQ. After that, the pH was adjusted to 7.0 by adding 5N NaOH. The final required volume was brought by adding more of AMQ. Prepared media was then, autoclaved at 121°C, 15 psi pressure for 15 minutes.

    Preparation of competent cells

    Materials required

    • Filtered transformation buffer, SOB and SOC media, glycerol stock of E. coli cells, liquid N₂, DMSO, shaker and static incubator, centrifuge, spectrophotometer

    Procedure

    • From commercial preparation of E. coli DH5α cells, a small volume of cells were collected by inoculation loop and streaked on LB agar plate and placed in static incubator for overnight at 37°C.
    • A single isolated colony was then, inoculated in 5 ml of SOB media in a polypropelene tube which was then, placed on a shaker incubator for overnight at 37°C and 200 rpm.
    • Next day, 1% culture (2.5 ml) was inoculated in 250 ml of SOC media in an erlenmeyer flask (SOC media was prepared by adding 2.5 ml of 2M filtered glucose in 250 ml of SOB media) and was placed on shaker at 18°C for around 20-24 hours until desired O.D. of 0.6-0.7 was achieved.
    • When the O.D. reached 0.6-0.7, the flask was placed on ice for 10 minutes and culture was then, aliquoted to 50 ml in five 50 ml polypropelene tubes and then, spun down by centrifuging at 4000 rpm for 10 minutes at 4°C and the supernatant was discarded.
    • Pellet was resuspended in 80 ml of transformation buffer (16 ml of buffer per 50 ml polypropylene tube) and stored in ice for 10 minutes.
    • Suspension was again centrifuged at 4000rpm for 10 minutes at 4°C and supernatant was discarded.
    • Pellet was again resuspended by adding 20ml of transformation buffer and 1.4 ml of DMSO and then, 200 µl of the suspension was aliquoted in 1.5 ml microcentrifuge tubes and snap frozen in liquid N₂ and finally, were stored at -80°C.

    Determination of transformation efficiency of E.coli DH5α competent cells

    Materials required

    • E. coli DH5α competent cells, puc19 vector, ampicilin plate, LB media, thermomixer/water bath at 42°C, centrifuge, static incubator, glass beads

    Procedure

    • E. coli DH5α competent cells and puc19 plasmids were thawed on ice and 10 pgm of vector was added to 100µl of competent cells.
    • Cells were incubated on ice for 15-20 minutes.
    • After that, heat shock was given at 42°C for 60 seconds.
    • Again, cells were kept in ice for 5 minutes.
    • 900µl of LB media was added to cells and then, placed them on shaker for 1 hour at 37°C and 200 rpm for revival.
    • After one hour, 100µl of culture was plated on an ampicilin plate and rest of the culture was centrifuged at 5000 rpm for 5 minutes at 25°C.
    • Pellet was resuspended in the left over 100 µl of supernatant and plated on another ampicilin plate.
    • Using glass beads, culture was spreaded uniformly on plates till the surface dried up. Then, plates were placed on static incubator for overnight at 37°C. Next day, colonies on the plates were counted and calculated transformation efficiency.

    Phenol-Chloroform Extraction of puc19, p004S and pENTR-Hyg+ Plasmids from E. coli DH5α cells

    Materials required

    • P1 buffer (25mM Tris-Cl pH 8.0, 10mM EDTA pH 8.0)
    • P2 buffer (0.2N NaOH, 1% SDS)
    • Ice-cold P3 buffer (For 300 ml P3 buffer, added 88.4g of Potassium acetate, then added 34.5 ml Glacial acetic acid for bringing pH to 5.5 and then, added H2O for bringing the final volume)
    • RNase (10mg/ml), isopropanol, 1X TE buffer (10mM Tris, 1mM EDTA), tris-saturated phenol, chloroform, 3.3 M Na-acetate, 100% ethanol (Pre-chilled at -20°C), 75% ethanol, AMQ, centrifuge

    puc19, p004S and pENTR-hyg+ were separately transformed in E. coli DH5α cells and then, each suspension was inoculated in LB media containing ampicilin, hygromycin and kanamycin respectively and placed on shaker for overnight at 37°C and 200 rpm. Next day, cells were spun down by centrifuging at 4000 rpm for 10 minutes at 4°C and supernatant was discarded.

    Procedure

    • Pellets were washed with 1X PBS by spinning at 13000 rpm for 1 minute at 4°C and supernatants were discarded.
    • Pellets were resuspended in 750 µl of P1 buffer containing 1% volume of RNaseA and then, each suspension was divided into three microcentrifuge tubes, 250µl in each.
    • 250µl of P2 buffer was added in each and mixed gently by inverting 4-5 times. Mixtures were then, incubated for 5 minutes at room temperature.
    • After that, 350 µl of ice-cold P3 buffer was added and again mixed gently by inversion and incubated for 5-10 minutes at 4°C.
    • Mixtures were then, centrifuged at 13000 rpm for 10-15 minutes at 4°C and the supernatants were collected in fresh microcentrifuge tubes.
    • 0.7 volumes (560µl) of isopropanol was added in each supernatants and mixed by vortexing for 1 minute and centrifuging at 13000 rpm for 10-15 minutes at 4°C.
    • Supernatants were discarded and tubes were carefully tapped on tissue paper and kept at 37°C until isopropanol dried up.
    • Pellets were again resuspended in 200µl of 1X TE buffer and mixed by vortexing for 1 minute.
    • Equal amount of phenol i.e. 200 µl was added and mixed by vortexing for 30 seconds and centrifuged at 13000 rpm for 1 minute at 25°C.
    • Lower organic layer was removed by pipetting and after that, equal amount i.e. 200 µl of chloroform was added and mixtures were vortexed for 30 seconds and centrifuged at 13000 rpm for 3-4 minutes at 25°C.
    • Lower organic layer was removed by pipetting and rest was again centrifuged for 2 minutes at 25°C for 13000 rpm.
    • Upper aqueous layer was collected in fresh microcentrifuge tubes.
    • 1/10th volume (20µl) of 3.3 M Na-acetate and 2.5 volume (500µl) of 100% ethanol (pre-chilled at -20°C) was added and vortexed.
    • The solutions were incubated at -20°C for 10-15 minutes and then, centrifuged at 13000 rpm for 10 minutes at 4°C and the supernatants were discarded.
    • Lastly, the pellets were washed with 500µl of 75% ethanol by centrifuging at 13000 rpm for 10 minutes at 4°C and after discarding the supernatant, left out ethanol was dried and resuspended in 60µl of AMQ and stored at -20°C.

    Note

    • Incubation at room temperature for 5 minutes after adding P2 buffer facilitates efficient lysis of cells.
    • Incubation at 4°C for 5-10 minutes after adding P3 buffer facilitates formation of precipitate layer on top.
    • Isopropanol helps precipitate DNA.
    • Phenol denatures protein and after centrifugation, as being organic, settles in the bottom as a separate layer and denatured proteins settle at the interface of two layers. Similarly, being organic, chloroform settles at the bottom and is added to remove left out phenol content.
    • Sodium-acetate and 100% ethanol (pre-chilled at -20°C) are added to precipitate DNA.
    • 75% ethanol is added to wash out any salts, which can be problematic during subsequent reactions.

    Gel Estimation of the Prepared Plasmids on Agarose Gel

    Materials required

    • Prepared Plasmids, agarose powder, 1X TAE buffer (1 mM EDTA (pH 8.0), 40 mM Tris base, 20 mM Glacial acetic acid), gel casting tray, electrophoresis tank, comb, 1 kb DNA ladder, ImageQuant LAS 500 gel documentation system, AMQ

    Procedure

    • 2g of agarose powder was weighed on electronic weighing balance and transferred in a 500ml glass bottle.
    • 200 ml of 1X TAE buffer was added, in order to prepare 1% agarose gel.
    • Mixture was boiled in oven until no particles was visible.
    • Bring down the temperature of the agarose solution upto 50-55°C to be bearable to touch by wrist.
    • 6µl of EtBr (10mg/ml) was added and swirled the mixture 3-4 times to uniformly mix the contents.
    • Agarose was poured on gel casting tray which was sealed from all four sides and had comb placed in it and it was then, left undisturbed till it solidified.
    • DNA loading mixtures were prepared by adding in each 1 µl vector DNA, 4µl AMQ and 1µl 6X DNA loading dye and loaded in wells on agarose gel.
    • 5 µl of 1kb DNA ladder was loaded in the initial well on agarose gel.
    • Gel electrophoresis was performed at 120 V for around 1 hour and gel picture was obtained from ImageQuant LAS 500 gel documentation system.

    Desired bands of supercoiled forms of plasmids were cut from gel and later on, extracted from the gel.

    Note: 5µl of DNA ladder was used because the amount of DNA present in each band of ladder in this volume was specified by the manufacturer.

    Amplification of 5’ & 3’ Flanks of all Four Genes

    Designing of primers

    From mycobrowser, the sequences of each of the four genes with around 1100 bp upstream and downstream flanking region were copied and forward primer and reverse primer of around 17-18 bp size for each flank of a gene were chosen. PflMI site was added at both the ends of 5’ and 3’ flanks while SnaBI restriction site was added to 5’ end of forward and 3’ end of reverse primer of both the flanks. DraIII sites were added to both forward and reverse primer of 4493 3’ gene flank. 6 bp of leader sequence was also added to each primer on their 5’ end.

    Note

    • PflMI sites were added because it gives us benefit of including 5 nucleotides of our choice in its restriction site sequence within which it cleaves, so that after adding PflMI site with the 5 nucleotides of our choice on a fragment of DNA, and adding the complementary site of the enzyme on another fragment of DNA, when enzyme cleave both fragments, the two digested fragments can ligate with one another.
    • SnaBI sites were added to facilitate the linearization of AES by cleaving between joining of 5’ flank and 3’ flank with ori + cos region.
    • ‘cacc’ sequence was included in the leader sequence of each forward primer, because pENTR has the ability to uptake any insert having this sequence at the beginning of one of its end.
    • Leader sequence assists in restriction endonucleases digestion.

    PCR Amplification of 5’ & 3’ Flanks of 5438, 1889 and 4493 Genes

    Primers, initially in lyophilized form, were centrifuged to get collected in the bottom and then, resuspended in the AMQ with appropriate volume to bring final concentration of 100uM as given in the datasheet and then, suspended primers were stored at -20°C.

    Materials required

    • M. smegmatis genomic DNA, 10 µM stock of primers for 5438 5’ & 3’, 1889 5’ & 3’ and 4493 5’ & 3’ flanks, 5X GC Buffer, DMSO, MgCl2, dNTP, phusion polymerase, AMQ, Proflex PCR system, ImageQuant LAS 500 gel documentation system

    Procedure

    Composition of 50μl PCR reaction mixture -

    Composition of 50μl PCR reaction mixture with required volume of each component
    ComponentsRequired volumes
    Msm genomic DNA15 µl

    10 µm stock of primers (forward

    primer + reverse primer)

    2.5 µl + 2.5 µl
    5X GC buffer10 µl
    dNTPs1.25 µl
    DMSO1.5 µl
    MgCl21.5 µl
    Phusion polymerase0.5 µl
    AMQ15.25 µl
    Total50 µl

    Above constituents were added in 50 µl PCR tubes while keeping ice-cold conditions. The mixtures prepared were mixed and then, centrifuged for around 30 seconds to collect the mixture evenly at the bottom and were put in blocks of ProFlex PCR system with the given below temperature settings –

    PCR reaction stages with their required temperature and time durations
    StagesTemperatureTime durations
    Initial Denaturation 98°C3 minutes
    Denaturation98°C30 seconds
    Annealling65°C30 seconds
    Extension 72°C1 minute 20 seconds
    Final Extension72°C10 minutes

    After that, mixtures were kept at 4°C. The whole PCR mixtures were then, loaded on 1% agarose gel by adding appropriate amount of DNA loading dye in order to make 1X concentration from its 6X stock concentration and run at 120 V for around 1 hour.

    Amplicon bands of desired sizes were cut from the gel and later on, extracted from the gel.

    Note: Generally, the annealing temperature chosen for Polymerase Chain Reaction is about 5°C lower than the melting temperatures of the primers.

    PCR Amplification of 2629 5’ & 3’ Gene Flanks

    Phosphorylation of primers for 2629 5’ & 3’ gene flanks

    Materials required

    • Forward and reverse primers, PNK buffer, 10 mM ATP, PNK kinase, AMQ, incubator

    Procedure

    For phosphorylation of primers, composition of the reaction mixture is given below in the table :

    Composition of 20 μl phosphorylation reaction mixture with required volume of each component
     ComponentsRequired volumes
    Forward primers2.0 µl
    Reverse primers2.0 µl
    Pnk Buffer2.0 µl
    10mM ATP2.0 µl
    Pnk Kinase1.0 µl
    AMQ11.0 µl
    Total 20.0 µl

    Above components were added in microcentrifuge tubes and then, incubated at 37°C for one hour.

    In separate microcentrifuge tubes, 2.5 µl of phosphorylated primers of each gene flanks (5’ & 3’) was added and rest of the PCR mixture constituents were added according to 50 µl reaction volume. PCR was performed at the same conditions given in 3.5 section and amplicons were obtained from the gel.

    Note: Primers are phosphorylated to avoid later treatment of amplicons by PNK and also, if amplicons are to be cloned in dephosphorylated vectors. Dephosphorylated amplicons can be easily cloned in plasmid such as pENTR which by simply recognizing ‘cacc’ sequence at 5’ end of amplicons, internalise the insert.

    Gel Extraction of Amplicons of 5438, 1889, 2629 and 4493 5’ & 3’ Gene Flanks

    Material required

    • HiYield™ Gel/PCR DNA mini kit of RBC containing - QDF column, 2ml collection tube, QDF buffer, W1 buffer, Wash buffer (absolute ethanol added), AMQ, centrifuge, thermomixer

    Procedure

    • Gel Dissociation: 500µl of QDF buffer was added to the gel pieces and incubated at 55-60°C in thermomixer at 600rpm until the gel slice dissolved. During incubation, tubes were inverted every 2-3 minutes. Dissolved sample mixtures were then, cooled to room temperature.
    • DNA binding: After that, QDF columns were placed in 2ml collection tubes. Then, 800µl of the sample mixtures were transferred to the QDF columns and centrifuged at 4000 rpm at room temperature for 1-2 minutes. Flow throughs were discarded and QDF columns were placed back to the collection tubes. DNA binding step was repeated with the rest of the sample mixture.
    • Wash: After that, 400 µl of W1 buffer was added into the QDF columns and centrifuged at 10000 rpm for 1 min at 25°C. Flow throughs were discarded and again QDF columns were placed back on collection tubes.
    • After that, 600µl of wash buffer (absolute ethanol added) was added in the QDF columns and left to stand for 1 minute and then, centrifuged at 10000rpm for 1 minute and flow throughs were discarded.
    • Centrifuged at 13000rpm for 2 minutes to dry the column matrix.
    • Then, dried QDF columns were transferred to new 1.5 ml microcentrifuge tubes. After that, 20µl of warm AMQ was added and kept standing for 3-4 minutes to allow AMQ to get completely absorbed and then, centrifuged at 13000 rpm for 2 minutes at room temperature to elute the purified DNA and then stored at -20°C.

    Note: Warm AMQ elutes DNA more effectively.

    Cloning of 5’ & 3’ Flanks of 5438 and 1889 Genes in pENTR Plasmids

    pENTRD-TOPO-Map.png
      Circular map of pENTR

      Materials required

      • pENTR vector, insert (flanks), salt solution, AMQ, thermomixer

      Procedure

      Composition of the pENTR cloning reaction is –

      Composition of 3 μl pENTR reaction with required volume of each component
      ComponentsRequired volumes 
      pENTR vector0.25 µl
      Insert DNA (flanks)(10 ng/µl)1.0 µl
      Salt solution0.5 µl
      AMQ1.25 µl
      Total reaction volume3.0 µl

      After adding above components, reaction mixtures were then incubated at 25°C for 20 minutes on thermomixer and after that, placed on ice for 5 minutes.

      They were then, transformed in E. coli DH5α competent cells and each were plated on kanamycin plate. Plates were incubated overnight at 37°C.

      Next day, from the colonies grown on each plate, five of them were inoculated from each plate, each in 2ml LB media containing kanamycin and incubated on shaker overnight at 37°C.

      Next day, plasmids were isolated manually as given below –

      • Cultures were transferred in microcentrifuge tubes and pelleted at 10000 rpm for 2-3 minutes at 4°C and supernatants were discarded.
      • Pellets were washed with 1 ml 1X PBS by centrifuging at 13000 rpm for 1 minute at 4°C and supernatants were discarded.
      • Pellets were then, resuspended in 250 µl of P1 buffer containing RNaseA by vortexing for around 1 minute.
      • Equal amount of P2 buffer was added in each, and gently mixed by inverting the tubes 5-6 times and then, incubated for 5 minutes at room temperature.
      • After that, 350 µl of chilled P3 buffer was added in each tube and after gently mixing by inverting 5-6 times, suspensions were incubated at 4°C for 10 minutes and after that, centrifuged at 13000 rpm for 10 minutes at 4°C.
      • Supernatants were collected in fresh tubes and 0.7 volume (560 µl) of isopropanol was added. Mixtures were vortexed for even mixing and then, centrifuged at 13000 rpm for 10-15 minutes at 4°C and supernatant was discarded.
      • Pellets were washed by adding 500 µl of pre-chilled 75% ethanol and centrifuging at 13000 rpm for 10 minutes at 4°C. Supernatants were discarded.
      • Pellets were dried in incubator at 37°C and then, resuspended in 20 µl AMQ and stored at -20°C.

      Screening of Positive Transformants in pENTR-5438 and pENTR-1889 Plasmids

      Plasmids were digested with PvuII in a 20 µl digestion reaction.

      Compostion of each 20 µl reaction mixture

      Composition of 20 μl digestion reaction with required volume of each component
       ComponentsRequired volumes
      10 X NEbuffer 3.12.0 µl
      PvuII0.2 µl
      DNA 3.0 µl
      AMQ14.8 µl
      Total reaction volume20.0 µl

      After making reaction mixtures, the tubes were placed in static incubator at 37°C for 3 hours. After that, the mixture was run on 1% agarose gel and the gel picture was obtained.

      After analysing the pattern of digested DNA, 100 µl of one positive transformant containing E.coli suspension culture of both plasmids was inoculated in 10 ml LB media containing kanamycin and incubated on shaker overnight at 37°C. After that, centrifuged at 4000 rpm for 10 minutes at 4°C and the supernatant was discarded. pENTR constructs were then, manually isolated by phenol-chloroform DNA extraction method and DNA was then, estimated by running on agarose gel.

      Note: PvuII, a blunt cutter had been used, as its two restriction sites were present in the pENTR-flanks which was checked from NEB cutter website, one in the plasmid backbone and other in insert and thus, was convenient to screen for positive clones.

      Generation of 5438 and 1889 AES

      Digestion of pENTR-5438, pENTR-1889, p004S and pENTR-Hyg+ vectors

      Composition of digestion mixtures

      1. For pENTR-5438 (5’ & 3’) and pENTR-1889 5’

      Composition of 50 μl digestion reaction with required volume of each component
      ComponentsRequired volumes

      Gene flanks (5438 5’/

      5438 3’/ 1889 5’)

      20.0 µl
      10 X NEbuffer 3.15.0 µl
      PflMI1.0 µl
      PvuI3.0 µl
      AMQ29.0 µl
      Total reaction volume50.0 µl

      2. For pENTR-1889 3’

      Composition of 50 μl digestion reaction with required volume of each component
       ComponentsRequired volumes 
      Gene flank20.0 µl
      10 X NEbuffer 3.15.0 µl
      PflMI1.0 µl
      EcoRV1.0 µl
      AMQ23.0 µl
      Total reaction volume50.0 µl

      3. For p004S vector

      Composition of 50 μl digestion reaction with required volume of each component
      ComponentsRequired volumes 
      p004S vector20.0 µl
      10 X NEbuffer 3.15.0 µl
      PflMI1.0 µl
      AMQ24.0 µl
      Total reaction volume50.0 µl

      4. For pENTR-Hyg+ vector

      Composition of 50 μl digestion reaction with required volume of each component
      ComponentsRequired volumes
      pENTR-Hyg+10.0 µl
      10 X NEbuffer 3.15.0 µl
      PflMI1.0 µl
      AMQ34.0 µl
      Total reaction volume50.0 µl

      After adding the above constituents in each case, the mixtures were incubated at 37°C for 3 hours and then, after digestion, 4 µl of DNA loading dye was added in each tube and then, run on agarose gel. Desired bands were cut from the gel. DNAs were extracted from gel pieces as mentioned in section 3.7 and estimated their concentrations by visualization on gel.

      Note: PflMI and PvuI restriction sites in the corresponding pENTRs containing amplified flank were checked in NEB cutter website and by custom digest, seen the gel pattern after digestion with them and accordingly, were used to digest, in order to get amplified flanks separated from the vector backbone and other close-sized fragment. For the same purpose, PflMI and EcoRV were used to digest their corresponding pENTR. In other two cases, the same concept was applied to get desired bands separated from the rest.

      Four-piece ligation

      After estimation, the amount of ori + cos, hygromycin cassette, 5’ and 3’ flanks of each gene required for the ligation reaction was determined by using the formula given below -

      size of insertsize of vector × amount of vector × vector:insert ratio

      Set up ligation of ‘ori + cos : hyg+ : 5’ flank : 3’ flank’ at a ratio of 1:1:1:1 of both gene flanks separately.

      Amount of vector taken was 30 ng.

      Overnight ligation was done at 16°C in waterbath.

      Next day, the ligation was transformed in E. coli DH5α cells and plated on hygromycin plate.

      Developed colonies were inoculated in 2 ml of LB media containing hygromycin and placed in shaker for overnight at 37°C.

      Next day, DNA was isolated manually.

      Note: The ratio 1:1:1:1 was taken due to very little variation in size of all the fragments.

      Generation of 4493 and 2629 AES

      Digestion of 4493 and 2629 gene flanks

      Gel extracted PCR amplicons of both flanks of 4493 and 2629 genes were digested with PflMI.

      Composition of Digestion mixtures

      Composition of 50 μl digestion reaction with required volume of each component
      ComponentsRequired volumes 

      DNA (4493 5’ and

      2629 5’ & 3’)

      20 µl
      10 X NEbuffer 3.15 µl
      pflMI1 µl
      AMQ24 µl
      Total reaction volume50 µl
      Composition of 50 μl digestion reaction with required volume of each component
      ComponentsRequired volumes 
      DNA (4493 3’)20 µl
      10 X NEbuffer 3.15 µl
      DraIII1 µl
      AMQ24 µl
      Total reaction volume50 µl

      Note: PflMI and DraIII enzymes were used to digest the respective flanks in order to obtain insert with overhangs for subsequent ligation.

      After digestion, enzymes (PflMI and DraIII) were heat inactivated by incubating at 65°C for 20 minutes and digested product was precipitated by using the following protocol:

      Precipitation of above (4493 and 2629 gene flanks) enzyme digested products

      Procedure

      • After heat inactivating enzymes, the mixtures were kept at room temperature to bring it down to room temperature.
      • 150 µl of TE buffer was added to the sample followed by 20 µl of Na-acetate and 500 µl ethanol (chilled) and the mixture was then, kept at -20°C for 20 minutes.
      • After that, sample was centrifuged at 13000 rpm at 4°C for 15 minutes and the supernatant was discarded.
      • 500 µl of chilled 75% ethanol was added and again centrifuged at 13000 rpm at 4°C for 7-8 minutes and the supernatant was discarded and pellet was dried.
      • Pellet was resuspended in 10 µl of AMQ.

      Four-piece ligation was again set up with the precipitated gene flanks with the same ratio of 1:1:1:1 separately at 22°C for 2 hours.

      The vectors were then transformed into E. coli DH5α cells and plated on hygromycin plate. Next day, the colonies were inoculated in 2ml LB media containing hygromycin. Vectors were isolated manually from the overnight grown cultures of cells.

      Screening of Positive Clones of all AESs by Digestion with EcoRI

      Digestion conditions: 37°C for 5 hours

      Composition of 20 µl digestion reaction mixture

      Composition of 20 μl digestion reaction with required volume of each component
      ComponentsRequired volumes
      DNA3 µl
      NEB CutSmart buffer2 µl
      EcoRI-HF0.2 µl
      AMQ14.8 µl
      Total reaction volume20 µl

      Digestion conditions: 37°C for 5 hours

      After digestion, the mixture was run on 1% agarose gel after adding 4 µl of loading dye.

      Positive colonies were inoculated in 10 ml LB media containing hygromycin and incubated on shaker at 37°C at 200 rpm for overnight. Next day, cultures were centrifuged at 4000 rpm at 4°C for 10 minutes. The supernatants were discarded.

      Note: EcoRI was used for screening purpose as it had sites in the generated vectors, which after digestion, will give either a full band of hygromycin cassettes or fragmented ones, whereas the heavier band will be of oriE + cosλ with gene flanks.

      Spin Column Preparation of AESs of all Four Genes

      Materials required

      • 1X PBS, P1 buffer (PD1), P2 buffer (PD2), P3 buffer (PD3) of HiYield Plus™ Plasmid Mini Kit of Real Genomics™ of RBC, QPD column, collection tube, W1 buffer, wash buffer, AMQ, centrifuge

      Procedure

      • Pellets were washed with 1 ml 1X PBS by centrifuging at 13000 rpm at room temperature for 1 minute and supernatants were discarded.
      • Pellets were resuspended in 300 µl of P1 buffer by pipetting, then, 300 µl of P2 buffer was added and mixed by gentle inversion for 10-15 times.
      • After that, 400 µl of P3 buffer was added and mixed by gentle inversion for 10-15 times.
      • Centrifuged at 13000 rpm at room temperature for 10 minutes.
      • DNA Binding: 800 ul of supernatants were loaded in QPD columns already placed on collection tubes and centrifuged at 7000 rpm at room temperature for 1 minute. The flow throughs collected in collection tubes were discarded. Left out supernatants were again loaded, centrifuged and flow throughs were discarded.
      • Washing: QPD columns were washed by adding 300 ul of W1 buffer and centrifuging at 10000 rpm for 1-2 minutes. Flow throughs were discarded.
      • After that, again 700 ul of wash buffer was added and centrifuged at 11000 rpm at room temperature for 1 minute. Flow throughs were discarded.
      • Empty spin was given at 11000 rpm at room temperature for 1 minute and the QPD columns were placed on fresh microcentrifuge tubes.
      • 50 µl of warm AMQ was added in the center of the column of each sample and waited for 2-3 minutes and after that, centrifuged at 11.5 k rpm at room temperature for 1 minute and stored the samples at -20°C.

      Confirmation of AES of all Four Genes by Digestion with SnaBI

      Generated four AESs were again digested with SnaBI enzyme for final confirmation.

      Composition of the digestion mixture is as follows-

      Composition of 20 μl digestion reaction with required volume of each component
      ComponentsRequired volumes 
      DNA ( 4493/ 2629/ 5438 / 1889 gene)2.0 µl
      NEB CutSmart buffer2.0 µl
      SnaBI0.4 µl
      AMQ15.6 µl
      Total reaction volume20 µl

      Overnight digestion at 37°C.

      After digestion, run the mixture on 1% agarose gel after adding 4 µl of loading dye.

      Note: SnaBI was used to digest AES constructs for final confirmation because it cleave out the ori + cos region from the rest, and by analyzing the sizes of the fragments, can confirm for presence of AES constructs. The rest fragment is the linearized substrate, that is electroporated into the recombineering strain.

      RESULTS AND DISCUSSION

      Calculation of Transformation Efficiency

      Formula used-

      Transformation Efficiency=Number of coloniesμg of DNA×Final volume at recoveryVolume plated

      The transformation efficiency of the E. coli DH5α competent cells calculated was = 1.1 × \times10⁷ colonies per µg of DNA.

      Gel Estimation of Manual Prepared Plasmids (puc19, p004S and pENTR)

      The gel picture of manual prepared plasmids that was obtained from ImageQuant LAS 500 gel documentation system is shown below-

      Untitled.png10_1.png
        Gel picture showing different plasmids (with their different conformations i.e. open circular, linear and supercoiled) with resolved 1 kb DNA ladder.

        Supercoiled conformations being highly compact runs faster than other forms of plasmid, and therefore, the lower bands in each lanes are the supercoiled forms.

        By comparing the intensity of the vector DNAs with the DNA bands in ladder, concentrations of supercoiled DNAs were estimated and these are (in ng/µl)

        Plasmids with their estimated concentration
        PlasmidsEstimated concentrations 
        puc19~70 ng/µl
        p004S~35 ng/µl
        pENTR-Hyg+~200 ng/µl

        Designing of Primers

        After adding restriction sites and leader sequence to the hybridization sequence of each primers for amplification of upstream and downstream flanks of each four genes, the sequences of primers formed were as follows-

        • MSMEG-4493 5’ flank

        Forward primer: caccttccataaattggtacgtacaagccgctcgacgaactg

        Reverse primer: ttttttccatttcttggcgggcggttcgacgtgatc

        • MSMEG-4493 3’ flank

        Forward primer: caccttcacagagtgaggaccgtgacgacctgatc

        Reverse primer: ttttttcaccttgtgtacgtactgcggatgtcatgggac

        • MSMEG-2629 5’ flank

        Forward primer: caccttccataaattggtacgtaacgctgcgtgtcggcgact

        Reverse primer: ttttttccatttcttggatcgtggagatccgcttg

        • MSMEG-2629 3’ flank

        Forward primer: caccttccatagattggtgttggcggggcggaggaca

        Reverse primer: ttttttccatcttttggtacgtaggcacgcatcgagaccgac

        • MSMEG-5438 5’ flank

        Forward primer: caccttccataaattggtacgtaaaggcaccggctgcggcat

        Reverse primer: ttttttccatttcttggagcgccagagtcagagaac

        • MSMEG-5438 3’ flank

        Forward primer: caccttccatagattgggccggtggtggcaacgagt

        Reverse primer: ttttttccatcttttggtacgtagaacgtcgtggcgatgtac

        • MSMEG-1889 5’ flank

        Forward primer: caccttccataaattggtacgtacaggtgaatcccggtccg

        Reverse primer: ttttttccatttcttggaggtcgccgaccacgtcga

        • MSMEG-1889 3’ flank

        Forward primer: caccttccatcgattggtgggtgatcgacacaccg

        Reverse primer: ttttttccatcttttggtacgtagtcgaacccctttgcgcg

        Leader sequences in forward primers were designed to contain initial 4 bases of ‘cacc’ in order to get uptake by pENTR, whereas, other bases were arbitrary chosen.

        PCR Amplification of 5438, 1889, 2629 and 4493 Gene Flanks

        Untitled.png8.png
          Gel picture showing PCR amplicons of 5438 and 1889 gene flanks (around 1 kb in size) with resolved 1 kb DNA ladder. The actual size of amplicons of 5438 5’ & 3' and 1889 5' & 3' flanks (in picture) are - 962 bp, 964 bp, 902 bp and 893 bp respectively
          Untitled.png9.png
            Gel picture showing PCR amplicons of 4493 gene flanks (around 1 kb in size) with resolved 1 kb DNA ladder. The actual size of amplicons of 1889 5' & 3' flanks (in picture) are - 902 bp and 893 bp respectively.
            Untitled.png10.png
              Gel picture showing PCR amplicons of 2629 gene flanks (around 1 kb in size) with resolved 1 kb DNA ladder. The actual size of amplicons of 2629 5' & 3' flanks (in picture) are - 951 bp and 948 bp respectively.

              In some cases, some amount of primer dimers, a PCR by-product was also observed.

              Gel Estimation of Gel Extracted PCR Amplicons

              Untitled.png5.png
                Gel picture showing gel extracted PCR amplicons of 5438 (5' & 3') and 1889 (5' & 3') gene flanks with resolved 1 kb DNA ladder.
                Untitled.png6.png
                  Gel picture showing gel extracted PCR amplicons of 4493 5' & 3' gene flanks with resolved 1 kb DNA ladder.
                  Untitled.png7.png
                    Gel picture showing gel extracted PCR amplicons of 2629 5' & 3' gene flanks with resolved 1 kb DNA ladder.

                    The amplicons obtained of 5438, 1889 and 4493 gene flanks were non-phosphorylated and that of 2629 gene flanks were phosphorylated.

                    Estimated concentrations of DNA in bands

                    Estimated concentrations of gene flanks
                    Gene flanksEstimated concentrations 
                    5438 5’70 ng/2µl i.e. 35 ng/µl
                    5438 3’60 ng/2µl i.e. 30 ng/µl
                    1889 5’60 ng/2µl i.e. 30 ng/µl
                    1889 3’60 ng/2µl i.e. 30 ng/µl
                    4493 5’25 ng/µl
                    4493 3’30 ng/µl
                    2629 5’60 ng/µl
                    2629 3’60 ng/µl

                    Screening of Positive Transformants

                    Untitled.png3.png
                      Gel picture showing the digested bands of pENTR-5438 (5' & 3') after digestion with PvuII enzyme.
                      Untitled.png4.png
                        Gel picture showing the digested bands of pENTR-1889 (5' & 3') after digestion with PvuII enzyme.

                        Plasmids showing the 1989 bp (~2 kb) and 1590 bp (~1.6 kb) bands were having positive clones.

                        Digestion of pENTRs- 5438 and 1889 Gene Flanks, p004S and pENTR-Hyg+ Plasmids

                        Untitled.png2.png
                          Gel picture showing the bands after digestion with the respective enzymes and bands in boxes are the desired bands with their sizes written below the picture.
                          Untitled.png1.png
                            Gel picture showing the bands after digestion with the respective enzymes and bands in boxes are the desired bands with their sizes written below the picture.

                            After digestion, the gel patterns of each pENTR-5438 (5’ and 3’) and pENTR-1889 (5’ and 3’) must be contained with four bands of size - ~1.6 kb, ~950 bp, ~750 bp and ~250 bp.

                            The gel pattern of p004S must be contained with DNA bands of size - ~3.6 kb, ~1.6 kb and two more bands of size around 900 bp and 600 bp.

                            The gel pattern of pENTR-Hyg+ must be contained with three bands of DNA of size around ~1.6 kb, 1.3 kb and 1.0 kb.

                            The observed gel patterns were had some extra bands above the desired bands which may be due to the incomplete digestion of plasmid backbone.

                            14_1.png
                              Gel picture showing the gel extracted DNA
                              Sizes and concentrations of gel extracted bands
                               BandsSize (in kb) Estimated concentrations 
                              OriE + cosλ1.6 kb~25 ng/µl
                              Hyg+1.4 kb~50ng/µl
                              5438 5'962 bp~25 ng/µl
                              5438 3'964 bp~25 ng/µl
                              1889 5'902 bp~20 ng/µl
                              1889 3'893 bp~25 ng/µl

                              Screening of Positive Clones by EcoRI-HF Digestion

                              14_2.png
                                Gel picture showing the digested bands of 5438 and 1889 AESs after digestion with EcoRI-HF
                                14_3.png
                                  Gel picture showing the digested bands of 4493 AES after digestion with EcoRI-HF.
                                  14_4.png
                                    Gel picture showing the digested bands of 2629 AES after digestion with EcoRI-HF.

                                    5438 AES digestion resulted in 3.4 kb and 1.4 kb bands.

                                    1889 resulted in 3.35 kb and 1.36 kb.

                                    4493 AES resulted in 3414 bp, 943 bp and 491 bp.

                                    2629 AES resulted in ~3.5 kb and ~1.4 kb.

                                    Confirmation of AESs by SnaBI Digestion

                                    14_5.png
                                      Gel picture showing the four SnaBI digested AESs of all four genes.

                                      After digestion, each lane had two bands of size around 3.4 kb or 3.5 kb and other 1.6 kb.

                                      The upper bands are containing the hygromycin cassette, with 5’ and 3’ flanks of respective genes and the lower bands are the ori + cos regions of AESs.

                                      CONCLUSIONS

                                      In this project, various techniques have been learnt such as

                                      • Gel electrophoresis
                                      • Manual preparation of plasmids by phenol-chloroform DNA extraction
                                      • PCR (both simple and gradient PCR)
                                      • Gel extraction
                                      • Preparation of competent cells
                                      • Transformation
                                      • Restriction endonucleases digestions
                                      • DNA Ligations
                                      • Blue-white selection of puc19 cloned insert
                                      • Preparation of antibiotic plates
                                      • Spin column preparation of plasmids

                                      This project has led me understand a new method of genetic engineering of which I was not aware earlier. This internship has made me betterly know research students, their mind-set and way of handling problems. It has given me chance to apply some biotechnological concepts learnt in books to real setting. It has helped me improve my soft-skills.

                                      In future, this internship experience can benefit me in making project strategies and my training involving basic techniques of recombinant DNA technology will help me understand its newer concepts more easily.

                                      ACKNOWLEDGEMENTS


                                      I would like to give my heartfelt thanks to Dr. Vinay Nandicoori, who had given me this huge opportunity to get internship in his lab and chance to get exposed to the real world research. I am so thankful to him, to provided me with a wonderful project filled with opportunity to learn so many techniques.

                                      His personality and experience in scientific researches has inspired me a lot.

                                      I am very grateful to the Academies' (IASc-INSA-NASc) for giving me a wonderful opportunity to experience aspects of research by this internship.

                                      I am giving my warm thanks to my mentor, Dr. Basanti Malakar, whose good guidance and directions has led me to complete this project on time. She has given me the training of every technique so nicely and taught me perfectionism in every tasks. Her consistent support made me get good results and understand so many concepts in the context of the project.

                                      I am also extremely thankful to my seniors - Suresh Bhatia, Sidra Khan, Ankita Dabla and Biplab Singha. Their constant helping and support nature has made my journey easy and memorable. They always admired me for my achievements and provided me with their every possible help and guidance. They all had my journey so beautiful.

                                      I would also like to thank some other members of the lab - Meetu mam, Mehak, Saba mam, Savita mam, Ashima mam, Yogita, Priyadarshini and other lab members for all of their support and help.

                                      References

                                      • https://www.who.int/en/news-room/detail/30-10-2017-who-report-signals-urgent-need-for-greater-political-commitment-to-end-tuberculosis

                                      • https://www.cdc.gov/tb/default.htm​

                                      • www.tbonline.info/posts/2016/3/31/how-tb-infects-body-tubercle-1/

                                      • https://www.mayoclinic.org/diseases-conditions/tuberculosis/symptoms-causes/syc-20351250

                                      • Shiloh MU and Champion PA (2010). To catch a killer. What can mycobacterial models teach us about Mycobacterium tuberculosis pathogenesis?. 13,

                                      • Julia C. van Kessel, Laura J. Marinelli, Graham F. Hatfull, 2008, Recombineering mycobacteria and their phages, Nature Reviews Microbiology, vol. 6, no. 11, pp. 851-857

                                      • Julia C van Kessel, Graham F Hatfull, 2006, Recombineering in Mycobacterium tuberculosis, Nature Methods, vol. 4, no. 2, pp. 147-152

                                      • Julia C. van Kessel, Graham F. Hatfull, 2008, Mycobacterial Recombineering, Chromosomal Mutagenesis,Methods in Molecular Biology, pp. 203-215

                                      • Ina Poser, Mihail Sarov, James R A Hutchins, Jean-Karim Hériché, Yusuke Toyoda, Andrei Pozniakovsky, Daniela Weigl, Anja Nitzsche, Björn Hegemann, Alexander W Bird, Laurence Pelletier, Ralf Kittler, Sujun Hua, Ronald Naumann, Martina Augsburg, Martina M Sykora, Helmut Hofemeister, Youming Zhang, Kim Nasmyth, Kevin P White, Steffen Dietzel, Karl Mechtler, Richard Durbin, A Francis Stewart, Jan-Michael Peters, Frank Buchholz, Anthony A Hyman, 2008, BAC TransgeneOmics: a high-throughput method for exploration of protein function in mammals, Nature Methods, vol. 5, no. 5, pp. 409-415

                                      • Daniel N. Wilson, 2013, Ribosome-targeting antibiotics and mechanisms of bacterial resistance, Nature Reviews Microbiology, vol. 12, no. 1, pp. 35-48

                                      • https://mycobrowser.epfl.ch/genes/MSMEG_4493

                                      • https://www.uniprot.org/uniprot/A0R0S7

                                      • Meena LS and Chopra P and Bedwal RS and Singh Y (2008). Cloning and characterization of GTP-binding proteins of Mycobacterium tuberculosis H(37)Rv.. 42,

                                      • Rajni, Laxman S. Meena, 2010, Guanosine triphosphatases as novel therapeutic targets in tuberculosis, International Journal of Infectious Diseases, vol. 14, no. 8, pp. e682-e687

                                      • https://mycobrowser.epfl.ch/genes/MSMEG_1889

                                      • GTPases involved in bacterial ribosome maturation | The ...https://academic.oup.com/jb/article/153/5/403/2182707​

                                      • https://www.uniprot.org/uniprot/A0QTL7

                                      • https://mycobrowser.epfl.ch/genes/MSMEG_5438

                                      • https://mycobrowser.epfl.ch/genes/MSMEG_2629

                                      • L. Rodrigues, C. Villellas, R. Bailo, M. Viveiros, J. A. Ainsa, 2012, Role of the Mmr Efflux Pump in Drug Resistance in Mycobacterium tuberculosis, Antimicrobial Agents and Chemotherapy, vol. 57, no. 2, pp. 751-757

                                      • Machado D and Couto I and Perdigão J and Rodrigues L and Portugal I and Baptista P and Veigas B and Amaral L and Viveiros M (2012). Contribution of efflux to the emergence of isoniazid and multidrug resistance in Mycobacterium tuberculosis.. 7,

                                      • L. J. V. Piddock, 2006, Clinically Relevant Chromosomally Encoded Multidrug Resistance Efflux Pumps in Bacteria, Clinical Microbiology Reviews, vol. 19, no. 2, pp. 382-402

                                      • Jacob E. Lazarus, Alyson R. Warr, Carole J. Kuehl, Rachel T. Giorgio, Brigid M. Davis, Matthew K. Waldor, 2019, A New Suite of Allelic Exchange Vectors for the Scarless Modification of Proteobacterial Genomes

                                      Source

                                      • Fig 2: http://www.transomic.com/Vectors-and-Maps/pENTRD-TOPO.aspx#1fbc4c4d-f4b9-415a-a8ab-aaa55b16233b,7230599
                                      More
                                      Written, reviewed, revised, proofed and published with