Loading...

Summer Research Fellowship Programme of India's Science Academies

Detection of functional homology of FUN30 gene between Saccharomyces cerevisiae and Candida albicans

Biyas Mukherjee

Presidency University, 86/1 College Street, Kolkata 700073, West Bengal

Dr. Rohini Muthuswami

Jawaharlal Nehru University, NewDelhi, Delhi 110067

Abstract

FUN30 gene encodes for Fun30 protein, a DNA-dependent ATPase that binds chromatin. The protein is involved in DNA double-strand break processing and heterochromatin maintenance by chromatin silencing at telomere. The protein localizes to the centromeric regions of chromosomes. FUN30 gene is not essential for S.cerevisiae, but appears to be essential in Candida albicans; therefore both the copies of FUN30 gene cannot be deleted in the latter diploid fungus. The main objective of the project is the detection of functional homology between the FUN30 gene of Saccharomyces cerevisiae and the FUN30 gene of Candida albicans. A complementary assay among FUN30 deleted S.cerevisiae, a wild type S.cerevisiae with FUN30 and another complemented state of S.cerevisiae in which it’s FUN30 is replaced by FUN30 of Candida, should confirm our desired result. The main task is to prepare the required complementary states of S.cerevisiae: (1) ΔSC_FUN30 (FUN30 deleted state of S.cerevisiae) (2) WT_SC_FUN30 (wild type, having FUN30) (3) ΔSC_FUN30 /CAN_FUN30 (FUN30 of C.albicans in ΔSC_FUN30). The strain of S.cerevisiae used is YPH500. The genotype of YPH500 strain is MATα Ura3-52 Lys2-801_amber ade2-101_ochre trp1-Δ63 his3-Δ200leu2- Δ1. URA (Uridine) is one of the auxotrophic markers and can be used to detect URA positive S.cerevisiae strain by growing sample in ura deficient medium. Hence ΔSC_FUN30 strain can be easily distinguished, where FUN30 is replaced by URA gene. URA sequence from PYES2 vector (5.9kb) is used. Primers are designed for polymerase chain reaction for the following purposes (1) Deletion of FUN30 from S.cerevisiae by URA. (2) Incorporation of URA in wild type S. cerevisiae, approx. 250bp downstream of FUN30 (3) Introduction of C. albicans FUN30 in YHES plasmid (within BamH1 and Xho1 restriction sites) which is to be further incorporated within S. cerevisiae having its FUN30 replaced by URA. YHES plasmid remains episomal to the genomic DNA of S.cerevisiae in all three cases.

Keywords: yeast YPH500 strain, URA marker, YHES plasmid, PYES2 vector

Abbreviations

Abbreviations
HATHistone Acetyltransferase
HDACHistone Deacetylase
ATPAdenosine Tri Phosphate 
SWI/SNF SWItch/ Sucrose Non Fermentable 
 DSBDouble Strand Break 
 SDSSodium Dodecyl Sulphate 
ΔSC_FUN30FUN30 deleted S.cerevisiae 
ΔSC_FUN30/CAN_FUN30 Candida FUN30 in  FUN30 deleted S.cerevisiae 
 WT_SC_FUN30Wild type S.cerevisiae with FUN30
LB Luria Bertani 
 YPD/YEPDYeast Extract Peptone Dextrose 
URA Uridine 
PCRPolymerase Chain Reaction 
ddH2oDouble distilled water 

INTRODUCTION

Background

Chromatin remodeling, the rearrangement of chromatin from a condensed state to a transcriptionally accessible state, allows transcription factors or other DNA binding proteins to access DNA and regulate gene expression. Chromatin is the complex of DNA and histone proteins that are packed within the nucleus of mammalian cells. DNA is tightly condensed and wrapped around nuclear proteins called histones. This repeating DNA-histone complex, which consists of 146 base pairs of double-stranded DNA wrapped around the histone octamer, is called a nucleosome. The repeating units of nucleosome are commonly referred to appear as “beads on a string”. Generally, the more condensed the chromatin, the harder it is for transcription factors and other proteins that bind to DNA to access it and perform their duties. When chromatin is tightly packed, and not actively being transcribed it is in heterochromatin state. When chromatin is more loosely packed, and hence accessible for transcription it is in the euchromatin state. Epigenetic modifications in histone proteins like methylation, demethylation, acetylation and deacetylation can change the conformation of chromatin leading to activation or repression in transcriptional processes. A nucleosome comprises of a dimer of core histone proteins H2A, H2B, H3 and H4. It is seen that histones are involved in structural organization of chromatin in eukaryotic cells and can go through different post translational modifications that may alter their interactions with histone and DNA. Methylation, phosphorylation, ubiquitination, acetylation, sumoylation, ADP-ribosylation, citrullination, etc. are some of the different histone tail modifications. These modifications occur on the N-terminal tail domain, that lead to remodeling of the nucleosome structure into an open conformation which is more accessible to transcription complexes. These combinations of t modifications constitute the “histone code” which hypothetically can be read and interpreted by different cellular factors resulting in activation or repression in transcription. [ ​https://www.whatisepigenetics.com/chromatin-remodeling/​​]

heterochromatin +euchromatin.png
  • 1
Representation of condensed heterochromatin and relaxed euchromatin 

The most widely characterized chromatin-modifying complexes studied till date can be classified based on their modes of action, into two major groups, which are (i) ATP-dependent complexes, that use the energy of ATP hydrolysis and locally alter or destroy the association of histones with DNA, and (ii) histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes, that regulate the activity in transcription of genes by analysing the extent of acetylation of the amino-terminal domains of histones associated with them in the nucleosome.

It has been noted in almost all ATP dependent complexes that they mainly belong to Snf2 subfamily [. ​​J. L. Workman, 2000​​ ]. The ATP dependent chromatin remodelers have been classified into two major groups, (i) the SWI2/SNF2 group and (ii) the imitation SWI (ISWI) group [​​Philip C. Hanawalt, 1995​​​​]. Recently another class of ATP-dependent complex, containing Snf2-like ATPase and also showing deacetylase activity, has been described in several different groups and known as NURD, NuRD, NRD. [ ​Stuart L. Schreiber, 1998​ ][ ​Danny Reinberg, 1998​ ]

ATP dependent.png
    Representation of the mechanism of ATP dependent chromatin remodelers.

    HATs and HDACs both have been found to be associated with remodeling complexes. [ ​​Stuart L. Schreiber, 1998​​ ] Thus, it is obvious that HATs, HDACs, and ATP-dependent remodeling complexes can coregulate some promoters that are sensitive to nucleosomal structure. However, the mechanism of co-regulation is still unknown. According to some research papers, some hypothetical possiblities have been put forward like acetylation occuring first, acting either as a flag or by opening the chromatin structure directly. This allows a much easier way to remodel the nucleosomes. In support of this hypothesis, it has been shown that bromodomains, which are present in some SWI subunits (and also in nuclear HATs), specifically act on acetylated lysines in tail peptides of histone proteins. Alternatively, there is a possibility of these remodeling complexes to act first. This second option is supported recently by two papers. [ ​​J. L. Workman, 2000​​.]

    FUN30 is known to be a Swi2/Snf2 homolog in budding yeast that remodels chromatin both in vitro and in vivo. Fun30 has a very important role in homologous recombination, facilitating 5′-to-3′ resection of double-strand break (DSB) ends, that lead to exonuclease digestion of DNA bound to the nucleosome just next to the DSB. FUN30 deletion slows the resection rate considerably. ​[​J. E. Haber, 2012​​.]

    The function of FUN30 in Candida albicans has not been studied, neither do we know of any kind of functional similarity of the gene in Candida and Saccharomyces. My study comprised of detecting any functional homology of FUN30 gene in between Candida and Saccharomyces. This project is a small part of characterising genes in Candida since it is not a model organism and also a diploid organism.

    The co-relation between RTT109 and FUN30 has been seen in Candida albicans and if there is a functional homology of FUN30 in between Candida and Sachharomyces, then the co-regulation between RTT109 and FUN30 can also be established in Saccharomyces.

    FUN30 has also been noted to downregulate many chromatin remodeling genes like TEL, MEC, Snf2, MRC1, RAD9, RAD5 etc. in some prepared strains of Candida like BWP17 and SN152. Hence if functional homology detected, these can also be confirmed in Saccharomyces.

    Objective

    The objective is to detect functional homology of FUN30 gene between Candida albicans and Saccharomyces cerevisiae.

    Scope

    • The function of chromatin remodeler FUN30 can be vividly known, it's importance in cell wall formation in Candida and Saccharomyces, it's effect on virulence of these organims and potential targets for drug designs can all be observed later.
    • The possible functions in DNA damage repair of FUN30 can also be vividly known and used as a target for potential drug design in eukaryotic cells.

    LITERATURE REVIEW

    Information

    For many years biologists assumed that a nucleosome remained fixed in place in a particular position associated with DNA. But it has recently been discovered that eukaryotic cells contain chromatin remodeling complexes, protein machines that use the energy of ATP hydrolysis or covalent modifications to alter the structure of nucleosomes temporarily loosening the tight association of DNA and histones. The movement of the H2A-H2B dimers in the nucleosome core may lead to remodeling of chromatin while the H3–H4 tetramer is particularly stable and assumed to be difficult to rearrange. [ ​​Fig 3​​]

    handshake int.jpg
      The histone H3–H4 dimer and the H2A-H2B dimer are formed from the handshake interaction. An H3-H4 tetramer forms the scaffold of the octamer onto which two H2A-H2B dimers are added, to complete the assembly.

      The remodeling of nucleosome structure has two important consequences- (i) permitting ready access to nucleosomal DNA by proteins of gene expression, DNA replication, and repair. The nucleosome can remain in a “remodeled state” even after the dissociation of the chromatin remodelers gradually changing back to its original state. (ii) remodeling complexes also can catalyze alterations in the conformation of nucleosomes along DNA like even transferring a histone core from one DNA molecule to another in some. [.​​Fig 4​​]

      chr remod.jpg
        Model for the mechanism of some chromatin remodeling complexes

        The various modifications of the histone tails have several important consequences like histone acetylation leads to destabilisation of chromatin structure partly because adding an acetyl group removes the positive charge from the lysine residue, hence it becomes difficult for histones to neutralize the charges on DNA during chromatin compaction. The most widely accepted effect of histone tail modification is the ability to attract specific proteins to a particular stretch of modified chromatin, leading to further compaction of the chromatin or facilitating access to the DNA. [​​Peter Walter, 2007​​]

        As discussed earlier [​Sec. 1.1​], our gene of interest YAL019 ( FUN30 of S.cerevisiae) is an ATP dependent chromatin remodeler, located in chromosome 114919..118314. [​​https://www.yeastgenome.org/locus/S000000017/sequence​]​., whereas CR_07600W_A (orf19.6291) (FUN30 of C. albicans ) is not well characterised and not known whether it has same functions as YAL019.

        Summary

        • PRIMER DESIGNING( 3 SETS - ΔSC_FUN30 , WT_SC_FUN30, ΔSC_FUN30 /CAN_FUN30 )
        • TRANSFORMATION OF URA PLASMID PYES2
        • ISOLATION AND PURIFICATION OF PLASMID PYES2 FROM THE TRANSFORMANTS
        • PCR OF URA PLASMID PYES2 WITH FUN30 DELETION PRIMERS
        • REVIVAL OF YPH500 STRAIN OF S.cerevisiae IN YPD MEDIA
        • TRANSFORMATION OF PCR PRODUCT ( URA WITH FUN30 DELETION PRIMERS)IN YPH500 STRAIN OF S.cerevisiae IN URA DEFICIENT PLATES(Ura-/M-/C-/ His+)-ΔSC_FUN30
        • PCR OF Candida FUN30 GENOMIC DNA WITH ΔSC_FUN30/CAN_FUN30 PRIMERS
        • DIGESTION OF PCR PRODUCT ( Candida FUN30 GENOMIC DNA WITH ΔSC_FUN30/CAN_FUN30 PRIMERS) AND YepHES (YHES PLASMID ) WITH BamH1 AND Xho1 RESTRICTION ENZYMES.
        • ELUTION AND LIGATION OF THE DIGESTED PRODUCTS
        • TRANSFORMATION OF THE LIGATED PRODUCT IN COMPETENT CELLS JM109
        • ISOLATION OF THE PLASMID YHES LIGATED WITH CAN_FUN30 .
        • TRANSFORMATION OF YHES LIGATED WITH CAN_FUN30 .IN ΔSC_FUN30 TRANSFORMANTS .- ΔSC_FUN30/CAN_FUN30
        • PCR OF PYES2 WITH WT_SC_FUN30 PRIMERS
        • TRANSFORMATION OF PCR PRODUCT ( PYES2 WITH WT_SC_FUN30 PRIMERS)IN YPH500 STRAIN.- WT_SC_FUN30
        • COMPLEMENTATION ASSAY OF THREE TYPES OF TRANSFORMANTS ΔSC_FUN30, ΔSC_FUN30/CAN_FUN30, WT_SC_FUN30 IN H2O2 MEDIUM.

        METHODOLOGY

        Primer Designing

        The basics

        1) Primers were designed 5' -3' (left to right).

        2) Primers had a G≡C content 40-60%.

        3) Primers were designed such that it didnot have the scope for undergoing secondary structures (e.g. intra primer homology or loop formation).

        4) Runs of 4 or more bases or dinucleotide repeats were avoided.

        5) The ΔG value for dimer analysis was between 0 to -9 kcal/mol.

        6) The Tm was lower than the annealing temperature.

        7) The specificity of the primers were verified from NCBI Primer Blast so that the primer wouldnot bind to other genomic regions.

        Primer for ΔSC_FUN30

        1) Primers were designed with the help of the website IDT Oligoanalyzer.

        2) Fasta sequence of the required gene was downloaded from Saccharomyces genome database (SGD).

        3) The sequence of URA gene was taken from PYES 2 vector.

        4) The flanking regions of FUN30 gene of S.cerevisiae (60bp) was added right at the front of initial 10-12 bp of URA sequence for the forward primer.

        5) For the reverse primer, tailing 60bp of FUN 30 was added downstream of URA sequence and reverse complemented as a whole.

        Primer for ΔSC_FUN30
        ScURA3-FPATGAGTGGTTCGCATTCAAATGATGAGGATGACGTAGTGCAAGTGCCCGAGACGTCCTCTCTCCAGGAACCGAAATACA  
        ScURA3-RPTTATTCTTTGGTTCCCTTCGGTTTCGAGTTTTCATCATAAATTATATCCTCCAACATATCCTCAACCAAGTCATTCTGAG 

        Primer for WT_SC_FUN30

        1) Primers were designed with the help of the website IDT Oligoanalyzer.

        2) Fasta sequence of the required gene was downloaded from Saccharomyces genome database (SGD).

        3) The sequence of URA gene was taken from PYES 2 vector.

        4) URA gene was added 250bp downstream of FUN30 gene.

        Primer for WT_SC_FUN30
        ScDOWN_FUN30-FPGATGAAAACTCGAAACCGAAGGGAACCAAAGAATAAATAAATAAAAATATAGTAACTCCAGGAACCGAAATACA 
        ScDOWN_FUN30-RPGCTATACATACTAACCTATGTATATATACACATATATGTATATTATACTCTAGAACTCAACCAAGTCATTCTGAG 

        Primer of ΔSC_FUN30 /CAN_FUN30

        1) Candida albicans genome database was used to procure the Fasta sequence of Candida FUN30.

        2) Primers were designed with the help of IDT Oligoanalyzer.

        3) YepHES plasmid (YHES) has two restriction sites of BamH1 and Xho1 in its construct.

        4) BamH1 site was developed in the upstream of the forward primer prior to the initial 60bp of FUN30 gene of Candida.

        5) Xho1 site was introduced at the downstream of the tailing 60bp of Candida FUN30 to form the reverse primer which was further reverse complemented as a whole.

        Primer for ΔSC_FUN30 /CAN_FUN30
        CAN_FUN30_CL-FP CGCGGATCCATGAGTTGGTTTAGAAGAAATAAAC 
        CAN_FUN30_CL-RP CCGCTCGAGTCAACTATAAACTATTGACTCTAATG 

        Transformation of Plasmid PYES2 Containing URA3 Sequence

        Aim: To transform PYES2 plasmid in bacterial competent cell (JM109).

        Principle: The plasmid PYES2 was transformed again and isolated since the plasmid was very old and to gain higher efficiency. Competent cells are modified bacterial cells that have a porous cell wall through which they can take up foreign DNA easily and are ready to use. Generally cells cannot take up DNA that efficiently as competent cells which are exposed to special chemical or electrical treatments for introducing competency in them. Treatment with calcium ions is the standard method. ln CaCl2 method, the competency is introduced by pore formation in bacterial cell walls by prolonged suspension of them in high concentration of calcium. Ca+2 is divalently positive charged and envelopes the outer cell wall of the competent cell, facing attraction from the negative charge of DNA or plasmid to be inserted. DNA can then be forcefully entered in to the host cell by heat shock treatment at 42oC in transformation. Cells in the log phase are made competent more easily (approx 0.5 O.D.) since they have an active metabolism.

        Procedure:

        1. Preparation of competent cells

        1) Primary culture was produced by adding 100 µl of JM109 bacterial competent cells (glycerol stock) to 10ml of LB media and keeping it overnight in a shaker incubator at 37°C at 220 r.p.m.

        2) 1 % of primary culture was added to 50ml of LB media for secondary culture in the shaker incubator 37°C at 220 r.p.m till O.D. reached 0.5.

        3) The culture was put in ice for 15 mins.

        4) It was then centrifuged at 5000r.p.m. at 4°C for 10 mins.

        5) The supernatant was removed and the pellet is resuspended into 6 ml of CaCl2 (0.1M) and 24 ml of MgCl2 (0.1M) in ice.

        6) It was then incubated in ice for 30 mins.

        7) It was centrifuged at 5000 r.p.m for 10 mins at 4°C.

        8) The pellet thus formed was resuspended in 1225µl of 0.1M CaCl2 and 275µl of glycerol.

        9) 100ml aliquotes were made and stored at -80 °C.

        2. Transformation

        1) The plasmid PYES2 (2 µl ) was added to 100µl aliquots of competent cells.

        2) It was then incubated on ice for 30 mins.

        3) Heat shock was given at 42°C for 90 seconds.

        4) Then it was incubated in ice for 2 mins.

        5) 1ml LB media was added.

        6) It was then incubated for 45 mins at 37°C.

        7) It was then centrifuged at 5000 r.p.m. for 5 mins at 25°C.

        8) The pellet was resuspended in 100 µl of the same media.

        9) Plating was done in LB amp plates.

        10) The plates were left to grow overnight at 37°C incubation.

        Result: Transformants were seen on the plates.

        Inference: Transformation was successfully done. The colonies were further confirmed after plasmid isolation and concentration checked in agarose gel electrophoresis and measured in nanodrop.

        Isolation of Plasmid Pyes2 from the Transformants

        Aim: To isolate the plasmid PYES2 from the transformed colonies.

        Principle:

        1) Cell Growth and Harvesting: The procedure started with the growth of the bacterial cell culture harboring my plasmid. When sufficient growth has been achieved, the cells are pelleted by centrifugation to remove them from the growth media.

        2) Re-suspension: The pellet is re-suspended in a solution (solution I) containing Tris-Cl (pH=8.0), EDTA, glucose and RNase A. Bivalent cations (Mg2+, Ca2+) are needed for DNase activity. EDTA chelates bivalent cations in the solution thus prevents DNases from destroying the plasmid and destabilizes cell wall. Glucose maintains the osmotic pressure so the cells don’t burst and RNase A is included for degradation of cellular RNA during cell lysis.

        3) Lysis: The lysis buffer (solution 2) contains sodium hydroxide (NaOH) and the detergent Sodium Dodecyl (lauryl) Sulfate (SDS). SDS is to solubilize the cell membrane. NaOH helps to break down the cell wall, destroys the hydrogen bonding between the DNA bases, converting the double-stranded DNA (dsDNA) in the cell to single stranded DNA (ssDNA). This process is called denaturation which is the main part of alkaline lysis. SDS also denatures most of the proteins in the cells that leads to separation of proteins from our desired plasmid.

        4) Neutralization: The neutralisation buffer (solution3) containing CH3COOK and CH3COONa decreases the pH of the solution, resulting in a decrease in alkalinity. This helps in reformation of the once disrupted hydrogen bonds which eventually lead the ssDNA to renature with the dsDNA.

        5) Purification: The plasmid DNA free from the cell debris is in a solution containing lots of salt, EDTA, RNase and residual cellular proteins and debris, so it’s not much use for downstream applications. There are several ways of purification including phenol/chloroform extraction which was followed by ethanol precipitation in this case. The water-soluble DNA separates out in the aqueous phase, while the proteins get denatured within the organic layer in the bottom of eppendorf due to organic solvents. The aqueous phase containing the protein-free DNA is collected from the top. Ethanol precipitation desalts and concentrates DNA by changing its structure and precipitating it.

        Procedure:

        1) The primary culture tubes were centrifuged at 5000 r.p.m. at 4°C for 5 mins.

        2) 200µl of ice cold solution 1 was added to the pellet.

        3) The resuspension was vortexed and transfered in 2 ml eppendorf.

        4) 400µl of solution2 was added.

        5) The eppendorf tube is inverted 1-2 times in ice for 1-2 mins.

        6) 300 µl of ice cold solution 3 was added and the tube inverted 1-2 times for 3-5 mins.

        7) It was then centrifuged at 12000 r.p.m. at 4°C for 15 mins.

        8) The supernatant was taken out in 2 ml eppendorf tubes.

        9) 15-16µl of RNase was added and kept at 37°C for 1 hour.

        10) Equal volume of phenol: CHCl3 was added and mixed and then centifuged at 10000 r.p.m. for 10 mins. at 4°C.

        11) The upper aqueous solution was taken out in 1.5 ml eppendorf tubes.

        12) Equal volume of isopropanol was taken in the tube and left at -80°C for 45 mins.

        13) It was centrifuged at 10000 r.p.m. at 4°C for 10 mins.

        14) 1 ml 70% ethanol was added and centrifuged at 12000 r.p.m. at 4°C for 5 mins.

        15) It was dissolved in 30µl of M.Q. autoclaved water and stored at -20°C.

        Result: Plasmids isolated and purified correctly which was checked by measuring its concentration at the Nanodrop to be about 2500 ng/µl .

        Inference: The plasmid yield was sufficient.

        PCR of URA3 Plasmid PYES2 with FUN30 Deletion Primers

        Aim: To perform polymerase chain reaction of PYES2 plasmid with FUN30 deletion primers ScURA3-FP and ScURA3-RP.

        Principle: The principle of polymerase chain reaction is shown in a diagramatic representation[​ Fig 6​​].

        pcr.png
          Diagramatic representation of principle of PCR

          Procedure: The PCR master mix for 100µl is set up as follows:

          PCR mastermix (100µl)
          Buffer (XT) for PCR (10X)  10µl  
          ScURA3-FP (20mM)  10µl  
          ScURA3-RP (20mM)  10µl   
          MgCl2 (25mM)  16 µl  
          dNTP (25mM)  0.8 µl  
          M.Q water  51.2 µl  
          Enzyme XT 1 µl  
          Total amount   100µl  

          The following mastermix is distributed in two pcr tubes each having 50µl and inserted into the pcr machine with the following settings:

          pcr2.png
            Following stages 1,2 and 3 in the picture represent the denaturation,annealing and extension periods in this particular PCR reaction.

            Result: After PCR reaction, the PCR products were checked in gel electrophoresis and bands were seen at ~2.8kb.

            pcr3_1.png
              Gel image of PCR products with 1 kb marker at the rightmost lane, clearly shows the size of the PCR products ~2.8kb

              Inference: Since the size of the PCR product is ~2.8kb, hence the amplification is correct.

              Revival of YPH500 Strain of S.cerevisiae in YPD Media

              Aim: To revive YPH500 strain of S.cerevisiae in YPD media.

              Principle and Procedure: To revive YPH500 strain of S.cerevisiae, it's glycerol stock was plated in a YPD plate and left in 30 °C for 24-48 hours.

              Result: Colonies of YPH500 strain of S.cerevisiae was seen in the plate which was later used for primary culture of YPH500 in YPD media [.​​Fig 9​​].

              yeast.png
                 Colonies of YPH500 strain of S.cerevisiae

                Transformation of PCR Product (URA with FUN30 Deletion Primers) in YPH500 Strain of S.cerevisiae in URA Deficient Plates(Ura-/M-/C-/ His+) -ΔSC_FUN30

                Aim: To transform the PCR product (URA with FUN30 deletion primers) in YPH500 strain of S.cerevisiae in URA deficient plates (Ura-/M-/C-/ His+)-ΔSC_FUN30.

                Principle: Yeasts, eukaryotic model systems for studies exhibit fast growth and have dispersed cells. Transformation is the process by which foreign DNA is introduced into a cell, leading to a genetic modification. Yeast cell walls are degraded by treatment with enzymes to yield spheroplasts. These fragile cells take up exogenous DNA at a high rate. Recombinant DNA technology in yeast has advanced, and an array of different vector constructs are available like YPH500 strain used in this case. Lithium acetate method was used for transformation in this case. Lithium acetate has monovalent Li+ ions that give a positive charge to the cell wall and permeabilise the cell wall which is much harder than that of bacteria. PEG (polyethylene glycol) is essential for the attachment of DNA and help in increasing the porosity of cell wall thus increasing the transformation efficiency of both intact and spheroplast cells. Salmon sperm DNA (ssDNA) is a ready to use, sheared DNA solution that is used directly in the preparation of prehybridisation and hybridisation solutions. These ssDNAs are of different copies and act as carrier DNA, forming a meshwork on the cell wall of yeast. Hence the DNA to be transformed remains randomly base-paired with these ssDNAs to form triplex DNA structure.

                Procedure:

                1) Primary culture of YPH500 was done in 5 ml YPD media and left overnight at 30°C at 220 rpm.

                2) Secondary culture was performed in 50 ml YPD media and left at 30°C at 220 rpm till O.D reached 0.5. ( 5 hrs approx.)

                3) The cells were pelleted at 5000 rpm for 5 mins at 25°C

                4) The pellet was washed with autoclaved water.

                5) Then the pellet was washed with 0.1M CH3COOLi and centrifuged at 2500 rpm for 2 mins.

                6) The pellet was resuspended in 0.1 M CH3COOLi

                7) 15µl of 10 mg/ml ssDNA was heated at 95°C for 5 mins., cooled and added to 30 µl of PCR product (DNA to be transformed).

                8) Vortexed for 1 min.and incubated at 30°C for 30 mins.

                9) 700µl of plate mix consisting of 8:1:1 ratio of 50% PEG, 1 M CH3COOLi and ddH2O was added.

                10) Then it was vortexed for 2-3 mins and incubated at 30°C overnight.

                11) Heat shock was given at 42 °C for 45 mins.

                12) Then it was pelleted down at 5000rpm for 5 mins at 25°C.

                13) Then it was spread on selective media plates (Ura-/M-/C-/ His+) and incubated at 30°C.

                Result: Colonies were seen on the plates [.​​Fig 10​​​ Fig 11​​].

                yeast 2.png
                  FUN30 deleted transformant colonies
                  yeast 2.1.png
                    FUN30 deleted transformant colonies

                    Inference: Hence transformation was successful.

                    PCR OF Candida FUN30 Genomic DNA with ΔSC_FUN30/CAN_FUN30 Primers

                    The principle and procedure of PCR of Candida FUN30 genomic DNA with ΔSC_FUN30/CAN_FUN30 primers is same as the PCR of PYES2 plasmid with FUN30 deletion primers ScURA3-FP and ScURA3-RP. The primers used in this case were CAN_FUN30_CL-FP and CAN_FUN30_CL-RP.

                    Result: The PCR products are of the size 3.2 kb as seen after gel electrophoresis. ​[​Fig 12​​]

                    pcr4.png
                      3.2 kb size of PCR products with 1 kb marker at the rightmost lane . The part of the gel image blacked out was not related to our study .

                      Inference: Hence PCR amplification was done successfully.

                      Digestion of PCR Product (Candida FUN30 Genomic DNA with ΔSC_FUN30/CAN_FUN30 Primers) and YepHES (YHES Plasmid) with BamH1 and Xho1 Restriction Enzymes

                      Aim: To digest the PCR product (Candida FUN30 genomic DNA with ΔSC_FUN30/CAN_FUN30 primers) and YepHES (YHES plasmid) with BamH1 and Xho1 restriction enzymes.

                      Principle: Restriction enzymes cut specific sites of DNA to either form a blunt end or a staggered end. Splicing with the same restriction enzyme enables the ligation of 2 completely different DNA fragments.

                      Procedure: The following were added to the PCR product and the YHES plasmid for digestion:​[​Table 1​​]

                      Digestion mix 
                      Candida FUN30 genomic DNA YHES plasmid
                      DNA                            = 43µl   DNA                               = 0.4µl 
                      Cutsmart (10X) buffer = 5µl   Cutsmart (10X) buffer      = 5 µl  
                      BamH1 HF                 = 1 µl   BamH1 HF                       = 1 µl  
                      Xho 1                        = 1 µl   Xho 1                              = 1 µl  
                      total                         = 50 µl total = 50 µl ( 42.6 µl made  up with MQ autoclaved water)

                      Result: The digested products as visualised in gel electrophoresis is shown [​ Fig 13​​].

                      dig1.png
                      • 1
                      • 2
                      Digested products 

                      Elution and Ligation of the Digested Products

                      Aim: To elute and ligate the digested products Candida FUN30 genomic DNA and YHES plasmid.

                      Principle and Procedure:

                      Elution: The first step in extracting DNA is identifying the DNA band which is to extract, by illuminating under UV light. The desired band is then carefully cut by a Scalpel blade. There are several methods for extracting DNA from the agarose gels. The kit based method was followed in this case

                      1) 3 X volume binding buffer was added to the cut gel pieces in a 1.5 ml eppendorf tube.

                      2) Then it was kept in the heating block for 10 mins at 65°C .

                      3) Then it was transfered into a column and centrifuged at 12000 rpm for 1 min at 25°C.

                      4) 750µl of wash buffer was added and centrifuged at 12000rpm for 1 min at 25°C, followed by a free spin at 12000rpm for 1 min at 25°C

                      5) Preheated autoclaved water 20 µl was added to it.

                      6) Then it was incubated for 5 mins and centrifuged at 12000 rpm for 1 min at 25°C.

                      7) The concentration of eluted product was measured in nanodrop and was ready for ligation. The concentration of the eluted products were as follows [​ Table 2​​].

                      Concentration of eluted products
                      Eluted product ng/µl A260/280A230/260
                      YHES  10.3 2.02 0.04 
                      Candida FUN3011.2 2.01  0.35

                      Ligation: The ligation reaction was set up as follows and kept in water bath at 16°C for 14-16 hours.

                      Result: The result of ligation is checked by transforming the ligated product in highly competent bacterial cells JM109.

                      Transformation of the Ligated Product in Competent Cells JM109

                      Aim: To transform the ligated product in competent cells JM10.

                      Principle and Procedure: Discussed before [ ​Sec. 3​].

                      Result: Colonies were seen on the plates (LB amp plates) [​​Fig 13​​​]​.

                      lig1.png
                        ligated colonies

                        lig2.png
                        • 1
                        • 2
                         Ligated colonies streaked in LB amp plate.

                        Inference: The ligated plasmid from the colonies were isolated and double digested and were checked in gel electrophoresis.

                        Checking the Ligated Colonies

                        Aim: To check whether the ligated colonies were positive or not.

                        Principle and Procedure: This was done by double-digesting the ligated colonies by BamH1 and Xho1.

                        Result: The double digested second ligated colony showed a 3.2 kb fallout and another unknown band at 2.5 kb approx. which was not a desirable result [ ​ Fig 15​​].

                        CHECK2.png
                        • 1
                        • 2
                        • 3
                        • 4
                        • 5
                        • 6
                        gel image of double digestion.

                        The possible reasons for this undesirable result may be the star activity of Bam H1 restriction enzyme. Hence single digestion with BamH1 and single digestion with Xho1 was done for ligated colony 2 and double digestions for 3 hrs were done.

                        The result: Double digestion showed a band at 8 kb which suggested that the double digestion didn't take place at 3 hrs. The single digestions showed bands around 8 kb.

                        PCR of PYES2 with WT_SC_FUN30 Primers

                        Aim: To perform polymerase chain reaction of PYES2 plasmid with ScDOWN_FUN30-FP and ScDOWN_FUN30-RP.

                        Principle and Procedure: Discussed before.

                        Result: The PCR products were run in 0.8% agarose gel by gel electrophoresis to get the image of amplified product [ ​ Fig 16​​].

                        pcr 6.png
                          Amplified PCR product SC down FUN30 ( WT_SC_FUN30  ) at 2.8 kb approx . size with 1 kb marker at the rightmost lane 

                          Inference: Therefore the amplification is correct ( estimated size 2.8 kb ).

                          Transformation of PCR Product (PYES2 with WT_SC_FUN30 Primers)in YPH500 Strain - WT_SC_FUN30

                          Aim: To transform the PCR product (PYES2 with WT_SC _ FUN30 primers ) in YPH500 strain of S.cerevisiae in URA deficient plates (Ura-/M-/C-/ His+)-WT_SC_FUN30

                          Principle and Procedure: Same as discussed above in the case of ΔSC _ FUN30.

                          Result: Colonies were seen on the plates ​[​Fig 17​​​​Fig 18​​].

                          down 1.png
                            WT_SC_FUN30 colonies.
                            down2.png
                              WT_SC_FUN30 colonies.

                              Inference: Colonies were subjected to genomic DNA isolation and PCR of isolated genomic DNA with their respective primers to check if they are positive.

                              Confirmation of the Transformant Colonies of ΔSC_ FUN30 and WT_SC_FUN30

                              Aim: To isolate the genomic DNA of the colonies and to check if they are positive by PCR with their respective primers.

                              Principle and Procedure: Genomic DNA isolation :

                              1) Primary culture was given from the streaked colonies in 10 ml YPD media at 30°C for 24 hrs.

                              2) It was then centrifuged at 5000 rpm at 4°C for 5 mins.

                              3) The pellet was washed with 10 ml autoclaved H2O.

                              4) It was then centrifuged at 5000 rpm at 4°C for 5 mins.

                              5) The pellet was then resuspended in 500 µl lysis buffer. ​[​Table 3​​]

                              Lysis buffer composition
                              Tris 100mM 
                              EDTA 50mM  
                              SDS  1%
                              ddH2O 

                              6) Glass beads (0.7-0.8g) added and vortexed for 1 minute and kept in ice for 1 min. This is repeated for 6 times.
                              7) The liquid phase was removed and transfered to a 2 ml eppendorf tube.

                              8) 275 µl  of 7 M cold CH3COONH4 was added and incubated for 5 mins at 65°C in water bath.

                              9) Then kept in ice for 5 mins.

                              10) 500 µl of CHCl3 was added and centrifuged at 12000 rpm for 10 mins at 4 °C.

                              11) The supernatant was taken in 2 ml eppendorf tube.

                              12) RNase 5 µl was added at 37°C for 30 mins.

                              13) 800 µl of CHCl3 was added to remove RNase.

                              14) It was centrifuged at 10000 rpm for 10 mins. at 4 °C

                              15) The upper layer was put in another eppendorf and 1 ml isopropanol was added and precipitation was seen.

                              16) It was left at room temperature for 20 mins. and centrifuged at 10000 rpm for 10 mins and the supernatant was removed.

                              17) The pellet was kept in 70% ethanol for washing and centrifuged at 10000 rpm for 10 mins.

                              18) 40µl of autoclaved H2O was added and kept at 37 °C till the pellet dissolves completely.

                              19) It was stored at 4 °C.

                              streaked.png
                                colonies of   ΔSC _ FUN30 and  WT_SC_FUN30 streaked.

                                Result: The colonies of both the prepared strains ΔSC_ FUN30 and  WT_SC_FUN30 were checked by isolating their genomic DNA and doing a PCR of them by their respective primers and checking it in gel electrophoresis . It is seen that the bands of amplicons have a size of 2.8 kb which is the required estimated size.

                                genomic dna isolation image.png
                                  Gel image of PCR products of isolated genomic DNA of  ΔSC _ FUN30 and  WT_SC_FUN30

                                  Inference: Hence the colonies of ΔSC _ FUN30 and  WT_SC_FUN30 are positive.

                                  RESULTS AND DISCUSSION

                                  This project required three types of complemented states of S.cerevisiae ΔSC _ FUN30, WT_SC_FUN30 and ΔSC_FUN30 /CAN_FUN30 for complementation assay. ΔSC _ FUN30 andWT_SC_FUN30 states were isolated successfully, but ΔSC_FUN30 /CAN_FUN30 couldn't be completed within the limited time-period of internship. All the results and discussions for each and every step is accompanied with the methodology of each step [ ​Sec. 3​].

                                  The complementation assay of the 3 complemented states would probably show whether the FUN30 gene has a functional homology in S.cerevisiae and C.albicans.

                                  CONCLUSION AND RECOMMENDATIONS

                                  • I studied about the FUN30 gene and its lesser known functions in Candida albicans as well as in S.cerevisiae. I designed the primers, thus learnt the process while doing it. I have learnt many intricate details in lab work while working with Candida and Saccharomyces which are not model organisms. I even assisted my senior scholars with ChIP assay (Chromatin immunoprecipitation), transformation in Candida and operation of qPCR (RT PCR) and procured some knowledge about them.
                                  • The complementation assay is remained to be learned in this project. I would like to work with proteins and its purification, crystallography, RNA work, ELISA etc in the future.
                                  • The function of chromatin remodeler FUN30 can be vividly known, it's importance in cell wall formation in Candida and Saccharomyces, it's effect on virulence of these organims and potential targets for drug designs can all be observed later. So this research provides varied scope for all these studies in various fields of cell biology, drug therapy, signalling and microbiology.

                                  ACKNOWLEDGEMENTS

                                  I am grateful to my guide Dr. Rohini Muthuswami and all the research scholars in the lab who had chalked out the whole work outline for me along with making me understand the significance of each and every step taken forward in the project, the different tools in biotechnology and the intricate details behind every protocol. I would like to specially thank my mentor Mr. Prashant Maurya without whom this work would have been very difficult . I am thankful to him for showing such patience and listening to all my problems and solving them inspite of having such huge work pressure . I would also like to thank Mrs. Pramita Garai for being so cooperative and guiding me . I am also grateful to Miss Akanksha Kanojia for being such a free spirit and motivating through my ups and downs . I am also thankful to all the lab members for their cooperation and support. I am really blessed to have my internship in this lab and this experience will remain with me forever.

                                  References

                                  • https://www.whatisepigenetics.com/chromatin-remodeling/​

                                  • M. Vignali, A. H. Hassan, K. E. Neely, J. L. Workman, 2000, ATP-Dependent Chromatin-Remodeling Complexes, Molecular and Cellular Biology, vol. 20, no. 6, pp. 1899-1910

                                  • Jonathan A. Eisen, Kevin S. Sweder, Philip C. Hanawalt, 1995, Evolution of the SNF2 family of proteins: subfamilies with distinct sequences and functions, Nucleic Acids Research, vol. 23, no. 14, pp. 2715-2723

                                  • Jeffrey K. Tong, Christian A. Hassig, Gavin R. Schnitzler, Robert E. Kingston, Stuart L. Schreiber, 1998, Chromatin deacetylation by an ATP-dependent nucleosome remodelling complex, Nature, vol. 395, no. 6705, pp. 917-921

                                  • Yi Zhang, Gary LeRoy, Hans-Peter Seelig, William S Lane, Danny Reinberg, 1998, The Dermatomyositis-Specific Autoantigen Mi2 Is a Component of a Complex Containing Histone Deacetylase and Nucleosome Remodeling Activities, Cell, vol. 95, no. 2, pp. 279-289

                                  • V. V. Eapen, N. Sugawara, M. Tsabar, W.-H. Wu, J. E. Haber, 2012, The Saccharomyces cerevisiae Chromatin Remodeler Fun30 Regulates DNA End Resection and Checkpoint Deactivation, Molecular and Cellular Biology, vol. 32, no. 22, pp. 4727-4740

                                  • Bruce Alberts, Alexander Johnson, Julian Lewis, Martin Raff, Keith Roberts, Peter Walter, 2007, Molecular Biology of the Cell

                                  • https://www.yeastgenome.org/locus/S000000017/sequence

                                  Source

                                  • Fig 1: https://www.whatisepigenetics.com/chromatin-remodeling/
                                  • Fig 2: M. Vignali, A. H. Hassan, K. E. Neely, J. L. Workman, 2000, ATP-Dependent Chromatin-Remodeling Complexes, Molecular and Cellular Biology, vol. 20, no. 6, pp. 1899-1910Available: http://dx.doi.org/10.1128/mcb.20.6.1899-1910.2000Short name : J. L. Workman, 2000
                                  • Fig 3: https://www.ncbi.nlm.nih.gov/books/NBK26834/figure/A636/?report=objectonly
                                  • Fig 4: https://www.ncbi.nlm.nih.gov/books/NBK26834/figure/A645/?report=objectonly
                                  More
                                  Written, reviewed, revised, proofed and published with