Loading...

Summer Research Fellowship Programme of India's Science Academies

Cloning a gene promoter and assaying the activity of the promoter construct

Sristilekha Nath

Tezpur University, Napaam, Tezpur, Sonitpur, Assam 784028

Dr. Sanghamitra Sengupta

University of Calcutta 35, Ballygunge Circular Rd, Department of Biochemistry, Kolkata, West Bengal 700019

Abstract

Promoter is a specific DNA sequence, present upstream of a gene or at 5' end of transcription start site that recruits the basal transcription machinery and directs accurate initiation of transcription. Transcription in higher eukaryotes is regulated by the interplay of regulatory information encoded in the conserved promoter sequences called TATA box and distal enhancers. These promoter functions can be analysed using different experimental approaches. One of such method is to study promoters in vivo where the promoter of interest is joined with a ‘reporter’ gene whose product can be assayed to monitor the activity of the promoter controlling the reporter gene. Luciferase is an example of such reporter gene encoded by a plasmid of specific size with a multiple cloning site (MCS) placed immediately upstream of the reporter gene and an antibiotic resistance gene for selection of recombinant clones. The primary aim of the present study is to elucidate the activity of a cloned promoter after being successfully transfected into a mammalian cell. The methodology followed is isolation of genomic DNA from the cell, gene specific primer designing, PCR amplification of DNA followed by gel electrophoresis, elution of the amplified product from the gel, ligation with TA cloning vector and then transformation; colony PCR to determine the presence of the insert in the plasmid construct, which is followed by sub-cloning the insert into a pGL3 reporter vector, containing the reporter gene ‘luciferase’. The plasmid carrying the candidate promoter fragment in front of the reporter will then be transiently transfected to detect the promoter activity, which will be determined by the expression level of luciferase within the transfected cells.

Keywords: PCR, cloning, transformation, transfection, promoter assay

Abbreviations

Some of the abbreviations used in this report are listed below:

Abbreviations
PCRPolymerase Chain Reaction
MCSMultiple Cloning Site
TSS Transcription Start Site 
 PC3Prostate Cancer cell line
 SpSpecificity protein 
 TBPTATA box Binding Protein 
GTF General Transcription Factor 
 TETransformation Efficiency 
 LBLuria Broth 
 LALuria Agar
 dNTPdeoxyribonucleotide triphosphate
 AmpAmpicillin 
PLB Passive Lysis Buffer 
 PICProtease Inhibitor Cocktail 

INTRODUCTION

Background

Molecular processes inside the eukaryotic cells are tuned at various levels of gene expression namely transcription, translation, processing and finally localization of the ultimate product. At the transcriptional level, binding of protein transcription factors to specific DNA sequences is fundamental in gene regulation. Understanding such interactions would help explain theoretically how an organism is ‘computed’ from its DNA (Macquarrie et al., 2011). Transcription factors interact with DNA in a sequence-specific fashion to either increase or decrease transcription of gene targets, sometimes regulating multiple targets simultaneously, and targets, in turn, are frequently regulated by multiple factors. DNA-binding drugs are therefore considered as promising agents aimed at potential inhibition of unpaired transcription that could assist in several pathologies, including cancer (Hurley et al., 2002).

Other than the cis-acting DNA sequence elements that contribute to the process of transcription regulation,the simplest of all elements to locate are the promoters, as they are located just upstream of the transcription start sites (TSS) (Trinklein et al., 2003). The promoters of a gene encoding proteins bear a variety of DNA elements which plays an important role in specific recognition by transcription factors, binding of which participate in the control of gene expression (C. Vizcaíno et al., 2015). Therefore it is essential to study the promoter activity that eventually regulate the expression of a particular gene and thereby help us to identify various factors (e.g. Transcription factors, Polymerases, Enhancers etc.) and understanding their effect in expression regulation at transcription level.

The present study aims at analyzing the activity of CD14 promoter construct that has been cloned into a reporter vector, pGL3 thereby observing whether it helps enhancing the expression of the downstream protein or reducing it when transfected into PC3 (Prostate Cancer) cell line with the help of Dual-Luciferase Reporter Assay. The study also wants to investigate the probable binding site for Sp1 transcription factor in the CD14 promoter sequence using bioinformatics search tool and deciphering the effect of its binding in the gene expression.

Molecular processes inside the eukaryotic cells are tuned at various levels of gene expression namely transcription, translation, processing and finally localization of the ultimate product. At the transcriptional level, binding of protein transcription factors to specific DNA sequences is fundamental in gene regulation. Understanding such interactions would help explain theoretically how an organism is ‘computed’ from its DNA (Macquarrie et al., 2011). Transcription factors interact with DNA in a sequence-specific fashion to either increase or decrease transcription of gene targets, sometimes regulating multiple targets simultaneously, and targets, in turn, are frequently regulated by multiple factors. DNA-binding drugs are therefore considered as promising agents aimed at potential inhibition of unpaired transcription that could assist in several pathologies, including cancer (Hurley et al., 2002).

Objectives of the Research

  • To identify Sp1 transcription factor binding site within the CD14 promoter sequence.
  • Cloning of CD14 promoter into a reporter vector, pGL3.
  • To analyse the activity of the promoter construct in a mammalian cancer cell system.

LITERATURE REVIEW

Information

Sp1 is the founding member of the Specificity protein/ Krüppel-like factor (Sp/KLF) family of ubiquitously expressed transcription factors (Courey et al., 1989), which has been reported to have a total of 26 members and considered as one of the most well characterized transcriptional factors that binds to GC-rich sequences (Van vliet J et al., 2006). They are needed for the expression and regulation of different eukaryotic genes. The promoters of such eukaryotic genes bearing variety of DNA elements are recognized by protein transcription factor Sp1, which binding to them participate in the control of gene expression (Pugh & Tjian, 1990; Suske, 1999; Chu, 2012). At these promoters, RNA pol II forms complexes with a set of general transcription factors that bind to specific sites in DNA. These general factors are essential for basal transcription, as different from activated RNA pol II transcription. (Tora & Timmers, 2010) (Fig. 1).

newUntitled.png
    Schematic representation of transcriptional activation by Sp1. A model for trans-activation through co-activators, in which Sp1 binds to DNA with TATA-box containing site and indirectly interacts with TBP (TATA-binding protein) and other general transcriptional factors (GTFs) [Vizcaíno, C., et al.,2015]

    S.-Y. Park et al. reported that increased expression of a tissue-specific molecule enhances CD14 promoter activity through the interaction with Sp1 which contributes to tissue-specific gene expression during lineage-specific differentiation. In another study, CD14 expression was found to be modulated by SP1 through differential binding of the transcription factor to CD14 promoter due to allelic variation of rs5744454 in P. falciparum malaria. They have also reported that the binding of SP1 to CD14 promoter is sequence dependent (B. Chakraborty et al., 2018).

    Sp1 is often known to get over-expressed in several human cancers, where it is considered as a negative prognostic factor. Its target genes are mainly involved in cell proliferation and oncogenesis (Safe & Abdelrahim, 2005; Wierstra, 2008). Sp1-responsive genes have been reported to be among those belonging to the hallmarks of cancer, which comprise biological capabilities acquired during the multistep development of human tumors (Hanahan & Weinberg, 2011; Beishline & Azizkhan-Clifford, 2015).

    According to another study, Sp1 only obtained at a high expression level in the early stages of lung adenocarcinoma. Its expression was reduced in highly invasive lung adenocarcinoma cells and in patients with stage IV. A decrease in the Sp1 level in highly invasive lung adenocarcinoma cells were found to be resulted from instability of the Sp1 protein cancer because of higher sumoylation and ubiquitination (Hsu TI et al., 2012).

    METHODOLOGY

    Concepts

    Overall scheme of work

    Untitled_2.jpg
      Flow chart for the overall experiment

      The principles behind various techniques and methods used are explained as follows-

      PCR (Polymerase Chain Reaction)

      This is entirely performed biochemically or, in vitro. The enzyme used is DNA polymerase that directs the synthesis of DNA from deoxynucleotide substrates on a single-stranded DNA template in the 5' to 3' direction. Thus, if a synthetic oligonucleotide or primer is annealed to a single-strand template that contains a region complementary to the oligonucleotide, DNA polymerase can use the oligonucleotide as a primer and elongate its 3' end to generate an extended region of double-stranded DNA. One of them is complementary to the 5' end of one strand of the DNA to be amplified, and the other is complementary to the 5' end of the opposite strand. The DNA to be amplified is then denatured, and the oligonucleotides are annealed to their target sequences. At this point, DNA polymerase and deoxynucleotide substrates are added to the reaction, and the enzyme extends the two primers. This reaction generates double-stranded DNA over the region of interest on both strands of DNA. Thus, two double-stranded copies of the starting fragment of DNA are produced in this, the first, cycle of the PCR (Watson, James D. Molecular biology of the gene, 7th edition).

      The applications of PCR may include analyzing the presence of genetic diseases mutations in genetic testing, study of patterns of gene expression. Quantitative PCR can be utilized to quantitate the actual levels of gene expression in tissues and individual cells at different stages to see which genes are activated or inactivated. PCR may also be used in phylogenetic analysis of ancient DNA samples, in forensic analysis etc. 

      Gel elution

      DNA isolation is a critical step in molecular biology and is necessary to obtain a specific DNA fragment from the extracted DNA. After isolating plasmids from a cell, it may contain some chromosomal DNA contamination that might interrupt the further processing of cloning. Therefore it is better to recover the plasmid DNA by eluting it from agarose gels termed as, extraction. The first step in extracting DNA is to identify the DNA band which is to extract, by illuminating under UV light. The desired band is then carefully cut by a Scalpel blade.

      There are several methods for extracting DNA from the agarose gels. Recovery of DNA from agarose gels by electrophoresis onto DEAE-cellulose membrane is one of the rapid and effective methods. Electro-elution is another such method for DNA recovery especially for larger DNA fragments. In this method, the gel fragment of desired DNA band is placed into a dialysis bag with buffer. The bag is then placed into a gel box containing buffer and subjected to an electric current. The DNA extracted is precipitated from the solution. In another recovery method using DEAE cellulose membrane, the gel piece is slide into the slit of a DEAE cellulose paper which will bind the DNA. Then an electric current is applied in order to move the band in the paper. DNA is washed off from the paper which is then precipitated using ethanol. Freeze-thaw method of extraction is a commonly used and advantageous DNA recovering method which supports the common laboratory facilities.

      Ligation

      Ligation is the alignment of the ends of two (usually double-stranded) DNA molecules and the formation of a covalent linkage (phosphodiester bond) between them in one or both strands. A nick in the sugar-phosphate backbone of a double-stranded DNA molecule can be sealed simply by the formation of a phosphodiester bond. If nucleotides are missing, then it is called a gap which cannot be sealed by ligation alone. Ligation reactions may be blunt ended or sticky ended. In the former, the molecules to be joined do not have overhanging single-stranded ends, with a potential to reanneal which might have been generated directly by the action of a restriction endonuclease that gives a straight cut. In sticky-ended ligation, the molecules have complementary single-stranded ends which can base-pair, ligating the phosphodiester bond(s) to seal the nicks. The reaction is most efficient if the sticky ends complement each other exactly.

      DNA ligases generally prefer fully Watson-Crick base-paired dsDNA substrates to those containing mismatches. T4 DNA Ligase is an enzyme that can ligate nicks containing one or more mismatches near the ligation junction with high efficiency. It is encoded by bacteriophage T4, and produced on infection of E. coli cells which can carry out both blunt-ended and sticky-ended ligations in presence of ATP. It requires a 3'-hydroxyl and a 5'-phosphate group on the molecules to be joined. E. coli DNA ligase is an endogenous bacterial enzyme and requires nicotinamide adenine dinucleotide (NAD+) as a cofactor, but is unable to carry out blunt-ended ligations (Howe, C. 200;7 Simple cloning. In Gene Cloning and Manipulation, 2nd edition).

      TA cloning

      TA cloning is one of the simplest and most efficient methods for the cloning of PCR products. It exploits the terminal transferase activity of certain thermophilic DNA polymerases like Thermus aquaticus (Taq) polymerase. Taq polymerase has non-template dependent activity which preferentially adds a single adenosine (A) to the 3'-ends of a double stranded DNA molecule, and therefore most of the DNA molecules PCR amplified by Taq polymerase possess single 3'-A overhangs. The use of a linearized "T-vector" which has single 3'-T overhangs on both ends allows direct, high-efficiency cloning of PCR products, facilitated by complementarity between the PCR products 3'-A overhangs and vector 3'-T overhangs. The TA cloning method can be easily modified so that the same T-vector can be used to clone any double-stranded DNA fragment, including PCR products amplified by any DNA polymerase, as well as all blunt and sticky-ended DNA species. This technique is especially useful when compatible restriction sites are not available for the sub-cloning of DNA fragments from one vector to another. Directional cloning is made possible by appropriate hemi-phosphorylation of both the T-vectors and the inserts. With a single T-vector at hand, any DNA fragments can be cloned without compromising the cloning efficiency (Ming-Yi Zhou and Celso E. Gomez-Sanchez, Mol. Biol. (2000) 2(1): 1-7).

      Transformation

      Introduction of exogenous DNA into a recipient organism is called transformation. Transformation can occur naturally or by artificial methods when induced. The efficiency of uptake of DNA can be increased by the treatment of a range of chemicals, one of such is CaCl2. Under normal conditions, for example E. coli is not readily transformable so they are called non-competent cells, but treatment with ice-cold calcium-chloride solutions followed by a heat shock make them to uptake the DNA, which is now termed as competent cell. The heat shock step strongly depolarizes the cell membrane of CaCl2-treated cells and thus the cell’s interior becomes less negative and this potential difference ultimately allows the movement of negatively charged DNA into the cell. Electroporation is another method by which many cells can be induced to take up the foreign DNA by subjecting them to an electric shock (Howe, C. (2007). Simple cloning. In Gene Cloning and Manipulation, 2nd edition).

      Transformation Efficiency is the efficienct at which a competent cell can take up foreign DNA and expresses gene encoded by it. It can be calculated using the formula,

      Transformation Efficiency (TF) = Number of colonies/ DNA spread on plate in µg.

      Plasmid isolation

      A plasmid is a small piece of DNA, capable of self-replication, independent yet co-exists with the main chromosome in a bacterial cell. They are often circular and some of them are able to integrate into the main genome. Plasmids carry genes that are not usually present in the main chromosome, but in many cases these genes are nonessential to the bacterium, coding for characteristics such as antibiotic resistance, which the bacterium does not need if the environmental conditions are favorable (Brown, T. A. (Terence A.), Genomes 3, 3rd ed)

      When plasmid DNA is isolated and run on an Agarose gel, one might observe two, three or even four bands. These maybe in the form of supercoil, nicked circular, linear or single stranded circular. Circular single stranded plasmid settles at the bottom of the gel, super coiled form known to be the native form found in vivo appears at the second last position, nicked circular at the first and linear one at the second position of the gel when viewed as a band under UV- transilluminator.

      Restriction digestion

      Restriction endonucleases are part of the natural defence mechanisms of bacteria against invading viruses or other microbes bearing DNA from a foreign population of cells. Three types of restriction systems have been recognized which are called Types (or Classes) I, II and III, with their key properties. All the enzymes recognize particular DNA sequences, .most of the Type ΙΙ enzymes are known to produce staggered sites with short extruding single-stranded ends rather than giving blunt ends. In cloning purpose, these are used extensively to check whether the insert has got incorporated into the vector or not.

      Transfection

      Transfection is the process of introducing foreign DNA into the mammalian cells either by physical (e.g electroporation) or chemical (e.g cationic lipid or calcium phosphate reagents) methods. Lipofectamine reagents are widely accepted as “gold-standard” for the safe delivery of exogenous DNA or RNA into the host (Francesco Cardarelli et al., 2016). The positively charged surface of the liposome mediates the interaction of the nucleic acid with the cell membrane, allowing the fusion of liposome/nucleic acid transfection complex with the negatively charged cell membrane. The transfection complex is then thought to enter the cell through endocytosis.

      Bradford Assay

      The Bradford protein assay is used to measure the concentration of total protein present in a sample. The principle behind this assay is the binding of protein molecules to Coomassie dye under acidic conditions results in a color change from brown to blue and the absorbance is recorded at 595 nm. This method actually measures the presence of the basic amino acid residues: arginine, lysine and histidine, which contributes to the formation of protein-dye complex. (He, F. ,2011).

      Dual-luciferase reporter assay

      Luciferase is a beetle enzyme that catalyses the reaction of luciferin, to oxyluciferin in the presence of ATP and O2 and Mg2+ and thereby producing a yellow light (560 nm). It is a chemiluminescent assay since it requires a chemical modification to give the luminescence that can be detected by a luminometer.

      Luciferase reporter assay is a commonly used method for monitoring promoter activity in mammalian cells. The plasmids carrying a candidate promoter fragment in front of the reporter is transiently transfected into mammalian cells to detect promoter activity. Detection of the reporter protein in the cells and its expression level becomes the determining factor for the activity. A vector carrying a reporter gene for example ‘Luciferase’, extracted from firefly is expressed after placing it under an expression system which also helps in the expression of luciferase. Firefly luciferase catalyses the oxidation of luciferin (substrate) to a product oxyluciferin, which yields light at 560 nm. Dual-Luciferase Reporter Assay uses an internal control plasmid to normalize experimental variations, carrying gene for Renilla luciferase which is co-transfected into the mammalian cell. When expressed, it catalyses the oxidation of coelenterazine to coelenteramide, yielding light at 480 nm. Activity of both (Firefly and Renilla Luciferase) gives rise to bioluminescence. The normalized signal can be calculated by dividing the firefly to the renilla signal (Identification and Characterization of Regulatory Elements on Human Chromosome 20q12-13.2).

      luc-reaction-webpage-1746x1380_1.jpg
        Luciferase enzyme activity Gbiosciences.com. (2019).Lumino™ Firefly Luciferase Assay.

        Methods

        Sp1 Transcription Factor binding site search

        CD14 gene sequence was obtained from GeneCards and a bioinformatics analysis was performed using CONSITE tool (http://consite.genereg.net/) to locate the putative Sp1 binding sites within CD14 gene fragment to be used as a promoter.

        Primer designing

        CD14 gene specific primer was designed manually with the help of an online tool Oligo Calc (Oligonucleotide Properties Calculator) (http://biotools.nubic.northwestern.edu/OligoCalc.html).

        The GC content, length, melting point of the primers are displayed and also the self-complementarity could be checked using this tool.

        The reverse primer that was designed was reverse complemented, incorporating recognition sites for KpnΙ and XhoΙ in the Forward and Reverse primer respectively. The recognition sites for the enzymes are shown below:

        Restriction enzymes and their Recognition Sequences
        KpnΙ 5' GGTACC 3'  3' CCATGG 5'
        XhoΙ 5' CTCGAG 3'  3' GAGCAC 5' 

        The primer sequences are:

        5' GACGGTACCTTGGCCAATGTGTCTC 3': Forward Primer and

        5' ATTCTCGAGTGGTGGCAGGAGAT 3': Reverse Primer.

        Genomic DNA isolation from PC3 cells

        The protocol followed to isolate genomic DNA from PC3 cells using a QIAamp DNA Blood Kit (Qiagen, Hilden, Germany) was as follows:

        • 20μl QIAGEN Protease (or proteinase K) was pipette out into the bottom of a 1.5ml microcentrifuge tube.
        • 200μl sample was added to the microcentrifuge tube. Up to 200μl whole blood was used, plasma, serum, buffy coat, or body fluids, or up to 5 x 106 lymphocytes in 200μl PBS.
        • 200μl Buffer AL was added to the sample and was mixed by pulse-vortexing for 15s. To ensure efficient lysis, it is essential that the sample and Buffer AL are mixed thoroughly to yield a homogeneous solution.
        • Incubated at 56°C for 10 min. DNA yield reaches a maximum after lysis for 10 min at 56°C. Longer incubation times have no effect on yield or quality of the purified DNA.
        • The 1.5 ml microcentrifuge tube was briefly centrifuged to remove drops from the inside of the lid.
        • 200μl ethanol (96–100%) was added to the sample, and again mixed by pulse-vortexing for 15 s. After mixing, the 1.5 ml microcentrifuge tube was briefly centrifuged to remove drops from the inside of the lid.
        • The mixture was carefully applied from previous step to the QIAamp Mini spin column (in a 2 ml collection tube) without wetting the rim.
        • The cap was closed and centrifuged at 6000 x g (8000 rpm) for 1 min, followed by placing the QIAamp Mini spin column in a clean 2 ml collection tube, and the tube containing the filtrate was discarded.
        • The QIAamp Mini spin column was carefully opened and 500μl Buffer AW1 was added without wetting the rim. The cap was closed and centrifuged at 6000 x g (8000 rpm) for 1 min.
        • The QIAamp Mini spin column was placed in a clean 2 ml collection tube, and the collection tube containing the filtrate was discarded.
        • Carefully the QIAamp Mini spin column was opened and added 500 μl Buffer AW2 without wetting the rim. The cap was closed and centrifuged at full speed (20,000 x g; 14,000 rpm) for 3 min.
        • The QIAamp Mini spin column was placed in a new 2 ml collection and the old collection tube was discarded with the filtrate. Centrifugation was done at full speed for 1 min.
        • The QIAamp Mini spin column was placed in a clean 1.5 ml microcentrifuge tube, and the collection tube containing the filtrate was discarded. Carefully the QIAamp Mini spin column was opened and 200 μl Buffer AE or distilled water was added.
        • Incubation was done at room temperature (15–25°C) for 1 min, and then centrifuged at 6000 x g (8000 rpm) for 1 min.
        • The eluted DNA was stored at -20°C.

        PCR amplification

        The isolated genomic DNA containing CD14 promoter fragment of size 560bp was amplified by PCR (GeneAmp PCR System 9700, Applied Biosystems) using the specific primers.

        The reaction mixture contains:

        COMPONENTS VOLUME

        Taq flaxi buffer (5x) 1µl

        dNTPs (25mM) 1.5µl

        MgCl2 (25mM) 1.2µl

        Forward Primer (10x) 0.5µl

        Reverse Primer (10x) 0.5µl

        Taq Polymerase (5U) 0.2µl

        PCR water 7.1µl

        DNA sample 1µl

        The reaction was set up for 40 cycles with a total reaction volume of 15µl.

        12Untitled.png
          Programme set up for PCR

          Gel elution

          PCR amplified DNA product was eluted out of the gel using the following protocol:

          • DNA fragment from the Agarose gel was excised with a clean, sharp scalpel.
          • The gel slice was weighed in colourless tube. Three volumes of Buffer Q4 were added to one volume gel.
          • Incubated at 50°C for 10 minutes (or until the gel slice has completely dissolved)
          • The tubes were vortexed every 2-3 minutes to help dissolve gel.
          • After the gel slice has dissolved completely, the colour of the mix is checked whether it turns “Yellow”.
          • 1 volume of isopropanol was added to the sample and then mixed.
          • A QΙA spin column was placed in a provided 2ml collection tube.
          • To bind DNA, the sample is added to the QΙA quick column and centrifuged at 13,000 rpm for 1minute until all the samples have passed through the column.
          • The flow through was discarded and the QΙA quick column was placed back into the same tube.
          • 750µl Buffer of PE (to wash) was added to QΙA quick column followed by keeping it for 3 minutes and then centrifuged for 1 minute.
          • The empty column was again placed into the same tube after discarding, to remove excess buffer.
          • The QΙA quick column was placed into a clean 1.5ml collection tube.
          • To elute DNA, 40µl Buffer EB (10mM Tris-Cl, pH 8.5) was added to the centre of the QΙA quick membrane for 5 minutes and centrifuged the column for 1 minute.
          • The column was allowed to stand for 5 minutes and centrifuged for 1 minute.
          • After addition of buffer EB to the membrane, the incubation time was increased to 4-5 minutes (It can help increase the yield of purified DNA). It was followed by centrifugation at 13,000 rpm for 1 minute.
          • If the purified DNA is to be analyzed on a gel, 1 volume of loading dye is added to 5 volume of purified DNA.
          • The solution is thoroughly mixed by pipetting up and down before loading the gel.

          Cloning and sub-cloning

          The eluted PCR products were ligated into pTZ57R/T vector (InsTAclone PCR Cloning Kit, Fermentas) followed by sub-cloning in pGL3 basic vector (Promega, Madison, USA).

          LIGATION REAGENTS
          A. TA cloning ligation mixture (1x) contains: B. pGL3 cloning ligation mixture (1x) contains:
          COMPONENTS VOLUME COMPONENTS VOLUME
          Vector 1.5µl pGL3 Double Digested vector 3µl
          5x Ligation Buffer 3µl 5x Ligation Buffer 6µl
          PCR eluted product 5µl PCR eluted product 10µl
          H2O 5µl Water (if dilution is preferred) 10µl
          T4 DNA Ligase 0.5µl T4 DNA Ligase 1µl
          • The components were mixed thoroughly by tapping the tubes gently, followed by incubation at 4°C overnight in water bath.
          • Next day, heat inactivation was done at 65°C for 10 minutes in water bath. Sample was stored at -20°C.

          Competent cell preparation and transformation

          Overnight culture of E. coli DH5α (non-competent) cells in LB (Luria Broth) was made competent by CaCl2 method in chilled condition. This was followed by transformation of the cloned plasmids: TA plasmid and pGL3 vector with inserts by making the competent cells to uptake them. Transformed cells were allowed to grow in LA (Luria Agar), Ampicillin plates and kept for incubation at 37°C overnight.

          The protocol followed is given below:

          • 5ml of overnight culture in LB (from frozen/glycerol stock of non-competent E.coli DH5α) was kept at 37°C in orbital shaker.
          • 150µl of overnight culture was transferred in a 10ml LB solution in a test tube.
          • For getting the logarithmic phase of cells, it was incubated for 2 and half hours at 37°C in an orbital shaker at 160rpm.
          • After ensuring that cells are in logarithmic phase by the presence of a silky wave appearance, 1ml culture was transferred to pre-chilled (-20°C) 1.5ml MCTs and kept in ice for 10-20 minutes and metabolism of cells is arrested.
          • Then centrifuged at 4000 rpm for 5 minutes at 4°C, followed by discarding the supernatant aseptically.
          • Pellet was resuspended in 500µl of buffered CaCl2 and kept in ice for 10 minutes.
          • Centrifugation was done at 4000 rpm for 3 minutes at 4°C for washing. The supernatant was discarded by inverting the MCT.
          • The pellet was resuspended in 500-400µl of buffered CaCl2 and kept in ice for 2-4h.
          • Centrifugation was done at 4000 rpm for 5 minutes at 4°C.
          • The supernatant was discarded and the pellet was resuspended in 250µl of buffered CaCl2, storing at -80°C.

          Transformation was done following the protocol as follows:

          • Competent cells were thawed at 4°C
          • In ice, 10µl DNA, from 15µl reaction mix was added to competent cells (200µl) and incubated at 4°C for one and a half hours.
          • Heat shock was given at 42°C for 45 seconds and kept in ice for 2-3 minutes.
          • 900µl of LB was added into the competent cells and incubate at 37°C for 1 hour in orbital shaker.
          • Centrifugation was done at 2600 rpm for 5 minutes
          • 700µl of solution was discarded and the pellet was suspended in remaining supernatant.
          • 250µl of suspension was used to plate in LA (Amp+).
          • Incubation was done at 37°C overnight.
          • Plates with transformed colonies were observed next day followed by calculating their transformation efficiency.
          • Single colony was picked and streaked in a new plate overnight at 37°CA colony was selected and inoculated in 10ml fresh LB with Amp+ and overnight incubation was done at 37°C.

          Colony PCR

          Colonies from the transformed plates were directly added to the PCR reaction mixture.

          The reagents used are:

          COMPONENTS VOLUME

          Taq flaxi buffer (5x) 1µl

          dNTPs (25mM) 1µl

          MgCl2 (25mM) 0.8µl

          Forward Primer (10x) 0.4µl

          Reverse Primer (10x) 0.4µl

          Taq Polymerase (5U) 0.2µl

          PCR water 5µl

          DNA sample 1µl

          The reaction was set up for 40 cycles with a total reaction volume of 10µl.

          11Untitled.png
            Programme set up for Colony PCR

            Plasmid Isolation

            Transformed colonies were inoculated in LB media in separate test tubes containing Ampicillin (1:10 ratio) for selection followed by incubation at 37°C overnight. Next day, plasmid isolation was carried out using QIAprep Spin Miniprep Kit (Qiagen) following the manufacturer’s protocol:

            • The overnight bacterial culture was pelleted down by centrifugation at 8000 rpm for 3 minutes in a 2ml micro centrifuge tube (MCT). The step was repeated till the total culture pelleted.
            • Pellet was resuspended in 250µl buffer P1 and mixed thoroughly by pipetting and it was transferred to a 1.5ml MCT.
            • 250µl Buffer P2 was added and mixed thoroughly by inverting the tube 4-6 times until the solution becomes clear, not allowing the lysis reaction to proceed for more than 5 minutes.
            • 350µl Buffer N3 was added and mixed immediately by inverting the tube 4-6 times until the solution becomes clear.
            • Centrifugation was done for 15 minutes at 13000 rpm in table top micro centrifuge.
            • The supernatant was transferred to a fresh MCT and centrifuged for 5 minutes at 13000 rpm.
            • The supernatant was applied to the QΙA prep spin column by decanting or pipetting followed by centrifugation for 1 minute at 13000 rpm. The flow through was discarded.
            • The QΙA prep spin column was washed by adding 0.75ml Buffer PE which was centrifuged for 30 to 60 seconds at 13000 rpm followed by discarding the flow through.
            • Again the tubes were centrifuged for 1 minute to remove residual wash buffer.
            • The QΙA prep column was placed in a clean 1.5ml MCT. To elute DNA, 30µl Buffer EB was added followed by incubation for 5 minutes after adding the EB, then centrifuged at 13000 rpm for 1 minute.
            • 20µl of EB was added and centrifuged at 13000 rpm for 1 minute and sample was stored at 4°C.

            Restriction digestion

            Presence of the promoter fragment in the vectors was confirmed by performing restriction digestion reactions (Double digestion and Single digestion) with enzymes KpnΙ and XhoΙ.

            The reaction components used were for 1x concentration:

            COMPONENTS VOLUME

            Cloned plasmid 5µl

            10x Tango Buffer 1.5µl

            Restriction enzymes (30 Units each)-

            KpnΙ 3µl

            XhoΙ 3µl

            PCR-water 2.5µl

            The reaction mixture was kept for incubation at 37°C for 3 hours, which was followed by Agarose Gel Electrophoresis to observe the cut plasmids.

            Cell culture

            PC3 (Prostate Cancer) mammalian cell line was selected for transfection in our study. Approximately 2×105 PC3 cells were plated in each of the 6-well plate in triplicate using serum and antibiotic free RPMI medium. Cells were allowed to grow for 48h.

            Transfection

            pGL3 cloned plasmids after being isolated from the transformed cells were stored at -20°C. These plasmids were taken for transfection following Lipofection method using Lipofectamine 2000 reagent. Reagent Cocktail was prepared in required proportion according to the protocol. PC3 cells were transfected with 400ng of promoter constructs or empty pGL3-Basic vectors and 200ng of pRL-TK Luciferase reporter vector as control.

            Bradford assay

            Within 48h of transfection, cells were washed with PBS, scraped out of the well plate and pelleted down by centrifugation in separate micro centrifuge tubes. Cell pellets were resuspended in 100ml of 1x PLB (Passive Lysis Buffer) and 1ml of PIC (Protein Inhibitor Cocktail) each which ultimately lyses the cells. Centrifugation of the mixture would separate out the proteins in supernatant and cells in the pellet. Supernatant containing the total protein with unknown concentration was taken for estimation following Bradford method, measured in a Spectrophotometer.

            Sample preparation was done for Bradford assay by mixing the following compounds:

            COMPONENTS VOLUME

            H2O 800µl

            Protein sample 3µl

            Bradford Reagent 200µl

            Protein estimation of each tube containing the sample was done after thoroughly mixing all of the components and incubating the tubes in dark for 5- 10 minutes.

            Dual Luciferase Reporter Assay

            Firefly and Renilla luciferase activities were evaluated using dual luciferase reporter assay kit (Promega, Madison, WI). Luminescence was measured as relative light units (RLU) in GloMax 20/20 Luminometer (Promega, Madison, USA) using 7 ml of cell supernatant. Firefly luciferase activity was normalized with respect to Renilla luciferase. The change in normalized luciferase expression was denoted in fold changes of RLU relative to appropriate control (empty pGL3 basic vector).

            RESULTS AND DISCUSSION

            in silico analysis of Sp1 binding site in CD14 promoter

            A Bioinformatics search using CONSITE tool was conducted to identify the probable Sp1 Transcription Factor binding sites within the CD14 promoter sequence.

            For Transcription factor Sp1, five different sites were displayed, one of which was spanning −275 to −265 nucleotide position (the closest one) with reference to the Transcription Start Site (TSS) with a TF affinity cut-off of 80%.

            consiteUntitled.jpg
              Diagram of 1.0 kb promoter sequence showing positions of Sp1binding sites with respect to CD14 TSS.
              consensusUntitled.jpg
                Consensus binding sequence of Sp1 in CD14 promoter.

                PCR amplification of the isolated gene from PC3 cells

                Genomic DNA with CD14 promoter sequence was amplified by PCR using specific primers. It showed prominent bands near 500bp of the marker in the gel after performing Agarose Gel Electrophoresis when visualized under the UV-transilluminator, confirming the presence of CD14 gene fragment.

                Untitled.png
                  PCR amplification of CD14 gene fragment (Insert) (Lanes- L1, L2: PCR products; M: Marker)

                  Transformation of TA- cloned cells

                  Transformed cell culture of volume 250µl was spreaded on LB plates with Amp. Numerous colonies were observed in the plate inferring the presence of transformed cells.

                  p1.png
                    LB plates with Amp resistant transformed E. coli DH5α cells

                    Transformation Efficiency (TE) calculation:

                    Number of transformed colonies = 283

                    The amount of DNA transformed expressed in µg= 0.2 µg

                    DNA spread on plate in µg = µl of DNA in competent cell ÷ µl of competent cell spread × µg of DNA in competent cell

                    = 2µl × 0.2µg / 250µl

                    = 1.6 × 10-3 µg

                    TE = Number of colonies / DNA spread on plate in µg

                    = 283 / 1.6 × 10-3 µg

                    = 1.8 × 105 cfu / µg.

                    Transcription Factor was found to be 1.8 × 105 cfu / µg.

                    Isolated plasmid from transformed cells harboring TA constructs

                    Plasmid samples containing the promoter fragment after being isolated from the transformed cells were loaded on Agarose gel against the DNA ladder alongside.

                    Prominent bands were observed after the electrophoresis with the size of the insert, confirming successful isolation and presence of the plasmid in the eluted solution.

                    2Untitled.png
                      Bands of TA plasmid harboring the construct isolated from the transformed cells (Lanes L1, L2: Isolated Plasmid; M- Marker)

                      PCR amplification of isolated plasmid confirms the presence of insert

                      To confirm the presence of promoter fragment in the plasmid isolated from the transformed cells, PCR amplification was performed using specific primer. When run on Agarose gel, bands with size around 500bp were observed suggesting the presence of the promoter construct in the plasmid.

                      3Untitled.png
                        PCR amplified product harboring the promoter construct (Lanes- L1, L2: PCR Product; M: Marker)

                        Restriction digestion of isolated TA cloned plasmid

                        A set of restriction digestion reactions were performed (SD- Single Digestion, DD- Double Digestion) using specific restriction enzymes KpnΙ and XhoΙ, recognition sites for which are present in the cloned plasmid as well. Agarose gel electrophoresis results determined the presence of the construct by the bands with the size of the same after the digestion reaction.

                        4Untitled.png
                          Bands of plasmid digested with KpnΙ and XhoΙ (Lanes- L1: Undigested plasmid; L2: Single Digestion (XhoΙ), L3: Single Digestion (KpnΙ); L4: Double Digestion (KpnΙ and XhoΙ); M: Marker)

                          Ligation of CD14 promoter fragment into pGL3 reporter vector and transformation

                          CD14 promoter fragment after the digestion with the enzymes were sub-cloned into another plasmid pGL3 via ligation reaction. Ligated products after being transformed into E. coli DH5α competent cells, were spreaded on LB plates with Amp.

                          Transformed colonies were found to be observed in the plates after keeping for 16h incubation at 37°C.

                          5Untitled.png
                            Transformed colony plates with pGL3 plasmid harboring promoter construct.

                            Transformation Efficiency calculation:

                            Number of transformed colony= 231

                            DNA spread on plate in µg = µl of DNA in competent cell ÷ µl of competent cell spreaded× µg of DNA in competent cell

                            = 2µl × 0.2µg / 250µl

                            = 1.6 × 10-3 µg

                            TE= Number of colonies/ DNA spread on plate in µg

                            = 231/ 1.6 × 10-3 µg

                            = 1.4 × 105 cfu / µg.

                            The transformation Efficiency was found to be 1.4 × 105 cfu / µg.

                            Colony PCR of pGL3 transformed cells

                            Agarose electrophoresis results of PCR amplified products showed the presence of insert in the pGL3 reporter plasmid, suggesting the successful transformation and presence of the construct.

                            6Untitled.png
                              Colony PCR (Lanes: L1-L7: colony PCR products; L8: Negative control; M: Marker)

                              Gel electrophoresis of isolated pGL3 plasmid with the insert

                              Bands in the gel confirmed the presence of pGL3 plasmid isolated from the transformed cells harbouring the promoter construct.

                              7Untitled.png
                                Isolated pGL3 plasmid from transformed cells (Lanes- L1: TA Plasmid L2, L3: pGL3 plasmid)

                                PCR amplification of pGL3 plasmid isolated from transformed cells

                                PCR amplification using CD14 specific primer followed by gel electrophoresis showed prominent bands for the CD14 promoter fragment when compared to the DNA ladder. It confirms the presence of the construct within pGL3 reporter vector.

                                8Untitled.png
                                  PCR amplification products (560bp) (Lanes- L1, L2: PCR Products; L3: Negative control; M- Marker)

                                  Restriction digestion of pGL3 cloned with CD14 plasmid

                                  Restriction digestion reaction (Double Digestion) with enzymes KpnΙ and XhoΙ results were when observed on Agarose gel, bands for the promoter fragment (insert) and the reporter plasmid (pGL3) were observed to get separated, inferring successful ligation of the previous mixture.

                                  9Untitled.png
                                    Bands after restriction digestion (Lanes- L1: Undigested pGL3 plasmid; L2: Double Digestion (XhoΙ and KpnΙ); M- Marker

                                    Analysis of promoter activity of the construct

                                    Dual-Luciferase reporter assay was performed to study the promoter activity. It was found that there was very little fold change of luciferase expression in the promoter construct as compared to the empty vector.

                                    luciUntitled.png
                                      Luciferase activity after transfection of empty vector and promoter construct containing CD14 promoter

                                      CONCLUSION

                                      In the present study, five putative Sp1 transcription factor binding sites were predicted to occur within 1 kb region of CD14 from in silico Trancription Factor Binding Site (TFBS) mapping analysis. Out of these five predicted sites, the one located within -275 to -265 nucleotide position was studied in this study as the site is in the most proximity to the TSS (Transcription Start Site). However the Luciferase Assay results obtained by transfection of the plasmid containing the promoter construct showed 6% increase of promoter activity compared to the pGL3 basic vector. The difference of the RLUs between the promoter construct and control vector is not statistically significant. Further experiments are however required to establish or rule out the importance of this Sp1 binding element with respect to CD14 transcription. First, the reporter assay needs to be replicated in other cell lines (THP1, U937, HEPG2) where CD14 primarily express. In addition there is a possibility that presence of some inhibitory factors might be perturbing the promoter activity in the transfected cells. Finally, cloning of a larger promoter construct containing all five Sp1 binding sites may help as because Sp1 binding to CD14 promoter may be cooperative in nature.

                                      The experiments performed in this short study when coupled with other assays such as, Chromatin Immunoprecipitation (ChIP assay), EMSA, Site ditected mutagenesis would provide us a definitive proof about the existence and functionality of a gene promoter.

                                      REFERENCES

                                      Trinklein, N. (2003). Identification and Functional Analysis of Human Transcriptional Promoters. Genome Research, 13(2), pp.308-312.

                                      MacQuarrie, K., Fong, A., Morse, R. and Tapscott, S. (2011). Genome-wide transcription factor binding: beyond direct target regulation. Trends in Genetics, 27(4), pp.141-148.

                                      Chakraborty, B., Mondal, P., Gajendra, P., Mitra, M., Das, C. and Sengupta, S. (2018). Deciphering genetic regulation of CD14 by SP1 through characterization of peripheral blood mononuclear transcriptome of P. faiciparum and P. vivax infected malaria patients. EBioMedicine, 37, pp.442-452.

                                      Hurley, L. (2002). DNA and its associated processes as targets for cancer therapy. Nature Reviews Cancer, 2(3), pp.188-200.

                                      Safe, S. and Abdelrahim, M. (2005). Sp transcription factor family and its role in cancer. European Journal of Cancer, 41(16), pp.2438-2448.

                                      Vizcaíno, C., Mansilla, S. and Portugal, J. (2015). Sp1 transcription factor: A long-standing target in cancer chemotherapy. Pharmacology & Therapeutics, 152, pp.111-124.

                                      Tora, L. and Timmers, H. (2010). The TATA box regulates TATA-binding protein (TBP) dynamics in vivo. Trends in Biochemical Sciences, 35(6), pp.309-314.

                                      Pugh, B. and Tjian, R. (1990). Mechanism of transcriptional activation by Sp1: Evidence for coactivators. Cell, 61(7), pp.1187-1197.

                                      Suske, G. (1999). The Sp-family of transcription factors. Gene, 238(2), pp.291-300.

                                      Wierstra, I. (2008). Sp1: Emerging roles—Beyond constitutive activation of TATA-less housekeeping genes. Biochemical and Biophysical Research Communications, 372(1), pp.1-13.

                                      Chu, S. (2012). Transcriptional regulation by post-transcriptional modification—Role of phosphorylation in Sp1 transcriptional activity. Gene, 508(1), pp.1-8.

                                      Hanahan, D. and Weinberg, R. (2011). Hallmarks of Cancer: The Next Generation. Cell, 144(5), pp.646-674.

                                      van Vliet, J., Crofts, L., Quinlan, K., Czolij, R., Perkins, A. and Crossley, M. (2006). Human KLF17 is a new member of the Sp/KLF family of transcription factors. Genomics, 87(4), pp.474-482.

                                      Courey, A., Holtzman, D., Jackson, S. and Tjian, R. (1989). Synergistic activation by the glutamine-rich domains of human transcription factor Sp1. Cell, 59(5), pp.827-836.

                                      Park, S., Shin, H. and Han, T. (2002). Synergistic interaction of MEF2D and Sp1 in activation of the CD14 promoter. Molecular Immunology, 39(1-2), pp.25-30.

                                      Hsu, T., Wang, M., Chen, S., Yeh, Y., Su, W., Chang, W. and Hung, J. (2011). Sp1 expression regulates lung tumor progression. Oncogene, 31(35), pp.3973-3988.

                                      Watson, j. (n.d.). molecular biology of the gene. 7th ed.

                                      Gomez-Sanchez, C., Zhou, M., Cozza, E., Morita, H., Foecking, M. and Gomez-Sanchez, E. (1997). Aldosterone Biosynthesis in the Rat Brain1. Endocrinology, 138(8), pp.3369-3373.

                                      Howe, C. (n.d.). Gene cloning and manipulation.

                                      Hughes, P., Fanning, E. and Kohiyama, M. (1992). DNA Replication: The Regulatory Mechanisms. Berlin, Heidelberg: Springer Berlin Heidelberg.Identification and Characterization of Regulatory Elements on Human Chromosome 20q12-13.2.

                                      Smale, S. (2019). Luciferase Assay.

                                      Brown, T. (2006). Genomes 3. New York: Garland Science.

                                      Bio-protocol.org. (2019). Bradford Protein Assay —BIO-PROTOCOL. [online] Available at: https://bio-protocol.org/bio101/e45 [Accessed 27 Jul. 2019].

                                      Biotek.com. (2019). Comparative Analysis of Dual-Luciferase® Assay Technologies in a High Throughput Microplate Format | March 18, 2016. [online] Available at: https://www.biotek.com/resources/application-notes/comparative-analysis-of-dual-luciferase-assay-technologies-in-a-high-throughput-microplate-format/ [Accessed 27 Jul. 2019].

                                      ACKNOWLEDGEMENTS

                                      I would like to express my deepest appreciation to all those who have provided me the opportunity to complete this report. A special gratitude to my guide, Dr. Sanghamitra Sengupta, Associate Professor, Dept. of Biochemistry, University of Calcutta, Kolkata, whose contribution in stimulating suggestions and encouragement, helped me to coordinate my project especially in the data interpretation while writing this report.

                                      I am extremely thankful to all the lab members for their constant support and help for encouraging me to understand the problem, solving them and perform the experiments during the entire duration of the project work.

                                      I express my sincere thanks to the Science Academies (IASc-INSA-NASI) for providing me the golden opportunity to undertake this wonderful project with the fellowship.

                                      Finally, I would like to thank my family and all my friends for making this scientific work a success.

                                      More
                                      Written, reviewed, revised, proofed and published with