Loading...

Summer Research Fellowship Programme of India's Science Academies

Developing epigenetic screens in Chlamydomonas

T. Gokul

Vivekananda college, Tiruvedakam-west, Madurai, Tamil Nadu 625234

Dr. Subhojit Sen

Ramalingasami fellow, UM-DAE Centre for Excellence in Basic Sciences, Mumbai

Abstract

The term ‘epigenetics’ coined by Waddington (1957) is defined as “the sum of the all alterations to the chromatin template that collectively establishes and propagates different patterns of gene expression (transcription) and silencing without genetic alterations to DNA”. Chlamydomonas reinhardtii, a unicellular eukaryotic green algae, is used as the epigenetic model in this study. (A) Effect of stress on epigenetic variegation: To study the effect of metal ion stress on C.reinhardtii (cc124 wild type), cells were grown. If these phenotypes are epigenetic, they can be interfered by a specific inhibitor. We recorded the growth curve by comparing C.reinhardtii under two growth conditions; -Mn control media, and 2X Zn + 3X Cu test media with (GSK343 polycomb inhibitor, 10uM) and without inhibitor. During this experiment the total number of cells and cell clusters (stressed) were counted. Our observations showed that the overall growth rate was similar under all conditions, proving that the inhibitor added was not toxic to the cells. (B) Cloning of a Fluorescent protein into pRNAi3 plasmid: In order to change the growth phenotype driven epigenetic assay to a visual format, we wanted to clone the mCherryCr gene (codon biased for Chlamydomonas), coding for a fluorescent protein (Beth A.Rasala et.al, 2013), into the pRNAi3 epigenetic vector. We transformed E.coli DH5a strain. After testing for background ampicillin resistance, a colony was chosen to make ultra-competent cells. These were transformed by heat shock method (at 42oC) with the pCC1G (RNAi3 plasmid) shuttle vector, and with another set of plasmids containing either TdTomato or mCherryCr or mCherryDs, the genes of our interest and ampicillin resistance gene as a selectable marker. These plasmids were extracted by alkaline lysis with SDS, to screen positive transformants, which were confirmed by using NcoI. These plasmids will now be used subclone the fluorescent protein gene into plasmid pCC1G.

Keywords: epigenetics, transformation, plasmid, fluorescent protein

INTRODUCTION

Epigenetics

The term ‘epigenetics’ coined by Waddington (1957) is defined as “the sum of the all alterations to the chromatin template that collectively establishes and propagates different patterns of gene expression (transcription) and silencing without genetic alterations to DNA”.

Position Effect Variegation (PEV)

PEV can be used to study epigenetic phenotypes and alterations of gene expression. When a gene in euchromatic region is juxtaposed with heterochromatin either by transposition or rearrangement, it results in variegated expression, i.e. differential levels in populations in spite of identical genetic background. Thus, genes which are normally active are now silenced after such transposition events. Since it is dictated by change in position of locus and not by changes in sequence of the gene itself, it is called as “position effect variegation” (PEV) (Elgin et al., 2013). Heterochromatin can be of two types, the more plastic facultative heterochromatin or the less reversible constitutive heterochromatin. Constitutive heterochromatin formation depends on interactions of H3-K9me2/3, heterochromatin protein 1 (HP1a) and H3-K9 histone methytransferases (HKMTs). It has been used as a tool to study heterochromatin formation in Drosophila. Suppressor of PEV are denoted as Su(var) i.e it cause loss of silencing and enhancer of PEV E(var) i.e., enhancer of variegation which cause increase in silencing of gene. Two Su(var) 3-9 related proteins were found in Chlamydomonas by (Cerutt et al.1997) and one of them was characterized and named as SET3p. This was found by expressing a eubacterial transgene, aadA in Chlamydomonas which conferred spectinomycin resistance which was transcriptionally suppressed by epigenetic mechanisms. These and other similar findings suggested a conservation for the role of heterochromatic chromosomal domains in transcriptional inactivation across the eukaryotic kingdom.

Chlamydomonas as a Model System

Chlamydomonas reinhardtii is a freshwater, green microalga that has become a popular model organism for photosynthesis and biotechnological research (Harris et al., 2009). [SS1] The vegetative cell measures about 7-10 mm in diameter. It is non-pathogenic, grows in simple defined minimal medium containing Tris- Acetate Phosphate (TAP) media along with trace elements. Chlamydomonas occupies as a cusp between animals and plants on the evolutionary tree, analysis of its genome will help to understand evolution of epigenetic correlates in the last common ancestor close to animals and plants (Merchant et al., 2007). Chlamydomonas harbors DNA methylation and hence can be tested for epigenetic effects (Feng et al., 2010). In addition Chlamydomonas genome also reveals genes that govern pathways of polycomb mediated histone methylation, histone deacetylation and RNAi mediated pathway.

Chlamydomonas transformation of nuclear, chloroplast and mitochondrial genome has been achieved (Harris, 2001). Several different antibiotic resistance genes have been used successfully for microalgal transformation selection e.g. paramomycin (Sizova et al. 2001, Jakobiak et al. 2004) resistnace gene that is used in this study. Several transgenic clones harboring the parmomomycin resitantce cassette at different gene loci, have been isolated in the laboratory, which show variegated epigenetic phenotypes with respect to antibiotic resistance (unpublished data). However, this screening method is laborious and time consuming as it depends on a long term growth phenotype (~10 days), to reveal epigenetic variegation. Adding a visual detection/screening marker along with this cassette will not only enable us to shorten the time required to assay for epigenetic phenotypes but also expand the screening method to a high-throughput format.

Fluorescent Proteins

The use of Chlamydomonas reinhardtii as a model system has been hindered by difficulties encountered in expressing foreign genes. The Fluorescent proteins (FPs)are used to measure gene expression, detection of epigenetic mutagens. FPs have become essential tools for a growing number of fields in biology. Currently GFP has been widely used in Chlamydomonas research. Other FP that has been expressed in Chlamydomonas is YFP (Neupert et al., 2009). Expression of GFP itself or as a chimeric protein in the chloroplast offers several advantages over nuclear expression, including higher levels of protein accumulation, which facilitates fluorescence detection and therefore utility, the disadvantage of chloroplast-expressed GFP is that it remains confined to the chloroplast.

FP applications are not available for organelle labeling and nuclear promoter studies, among many others. GFP expression from the nuclear genome has been severely hindered by low levels of protein expression, which has been attributed to the robust gene silencing mechanism(s) in Chlamydomonas (Fuhrmann et al., 1999; Neupert et al., 2009). The genes such as mCherry Cr, mCherry Ds, and tdTomato that code for fluorescent proteins have been successfully expressed in Chlamydomonas, which we can exploit to incorporate into the design of the epigenetic assay in this study.

Project proposal: Cloning of Fluorescent Protein into pRNAi3 Plasmid

In order to change the growth phenotype driven epigenetic assay to a visual format, we wanted to clone the mCherry Cr gene (codon biased for Chlamydomonas), coding for a fluorescent protein (Rasala et.al, 2013), into the pRNAi3 vector (pCrCDPK1GFP abridged to pCC1G in this study, from Motiwala et al[SS1] ) to develop a visual epigenetic assay. The aim of the present study was to develop a new plasmid, pCiG which can be used to create paromomycin transgenic clones of Chlamydomonas to study epigenetic variegation (Fig.1).

Objectives of the Research

1. Generate ultra- competent cells of E.coli DH5 α\alpha by the protocol developed by Innoue et al.

2. To transform and clone pBR9 mCherry plasmid in E.coli DH5 α\alpha and isolate plasmid for PCR.

3. Generation of cloning vector backbone: By removing UTR and GFP region of the plasmid using restriction digestion to isolate the cloning vector backbone from pCC1G.

4. Gel purify the PCR amplified gene products (mCherry and intron sequence from expression plasmid pBR9 mCherry Cr).

5. Ligation of pCC1G backbone with fluorescent protein gene template (Intron + Fluorescent protein as in Fig1) which results a new plasmid called as pCiG. This plasmid is expected to express mCherry Cr in the green microalga Chlamydomonas along with antibiotic resistance to Paromomycin.

exper design_1.png
    1 Experimental design of cloning fluorescent protein into pRNAi3 plasmid. A. Building of backbone plasmid B. Building of Cloning template.
    Details of 55F-R and 56F-R PCR Primer
    Primer Sr. No.
    Primer ID Description Sequence Tm %GC Primer length (bp) Volume of TE pH 8.0 added to reconstitute primers (100µM stock) Amplicon %GC Amplicon Size (bp)
    55 55F 2A-FP-3'UTR ggaattcatgccggtgaagcagaccctgaac (EcoRI) 71.44 58.33 24 478.84 µl mCherry Cr: 62.31% mCherry Cr: 963 bp
    55R gtctagaactcctccgctttttacgtg (XbaI) 59.38 50.00 20 508.29 µl
    56 56F Complete rbcs2 intron (+promoter) catcatatgaggtgagtcgacgagcaag (NdeI) 59.14 57.89 19 491.67 µl 57.61% 151 bp
    56R cgaattccatcctgcaaatggaaacg (EcoRI) 60.06 47.37 19 505.90 µl

    MATERIALS AND METHODS

    Requirements

    Equipments

    • Laminar air flow cabinet
    • Agarose Gel electrophoresis apparatus
    • Gel documentation system (Bio-Rad)
    • Shaker incubator
    • -200c and -800c freezer
    • Autoclave
    • Centrifuge
    • Micropipette and Water bath.

    Chemicals

    All chemicals used in the study were molecular biology grade and purchased either from Merck, NEB, Sigma or SRL Chemicals.

    Strains and plasmids

    1. E.coli DH α\alpha strain:

    E.coli DH5 α\alphastrain is a cloning strain with multiple mutations, it was developed by D. Hanahan (1983) and these are engineered to maximize transformation efficiency. This strain was revived form glycerol stock and purified to single colonies. After testing for background ampicillin resistance it used for transformation.

    2. Plasmids:

    pBR9 mcherry Cr, pBR9 mCherry Ds, pBR9 tdTomato, pCC1G, pCG plasmids were used in the experiment.

    Methods

    Culturing of Escherichia coli DH5 α\alpha cells

    Inoculate the E.coli DH5 α\alpha strain from glycerol stock in the LB agar plate by using sterilized tooth picks. The cells were grown at 370C for 24 hours. Then the colonies are re-streaked in the LB agar plate to get single isolated colonies.

    Short innoue protocol for bacterial transformation

    1. Preparation of ultra-competent cells:

    a. Culture the cells DH5 α\alphaon LB agar plate at 370C overnight.

    b. Pickup single colony, inoculate into 2ml LB broth and incubate for 6hrs.

    c. Then inoculate 1ml from LB culture into 25ml of SOB liquid media.

    d. Incubate the flask at 18oC with vigorous shaking (200rpm) until OD600=0.55.

    e. Place the flask in ice for 10 minutes and pellet the cells by centrifugation at 4000rpm for 10 minutes at 4oC.

    f. Gently re-suspend the cells by swirling in 20ml ice-cold TB and store on ice for 10 minutes. Spin at 4000rpm for 10 minutes at 4oC.

    g. Gently re-suspend the pellets in 2ml ice-cold TB.

    h. For storage add 7% DMSO to the cells and aliquot 100ml cells in multiple 1.5 ml sterile tubes and store it in -80oC.

    2. Heat shock transformation:

    a. Add 1ng/ml of plasmid DNA (pBR9 mcherry Cr, mCherry Ds, tdTomato) and pCG to the competent cells.

    b. Set up a tube as a negative control (a tube of competent cells receives no DNA).store the tubes on ice for 30 minutes. Swirl the tubes gently to mix the contents.

    c. Transfer the tubes to a rack placed in a preheated 42oC circulating water bath for exactly 60 seconds. Do not shake the tubes. Rapidly transfer the tubes to an ice bath. Allow the cells to cool for 1-2 minutes.

    d. Add 800ml of SOC medium to the each tube. Tape the tubes down to the floor of shaking incubator, set at 37oC. Incubate the culture for 45 minutes to allow the bacteria to recover and to express the antibiotic resistance marker encoded by the plasmid. To maximize the efficiency of transformation, gently agitate (<225 cycles/minute) the cells during the recovery period.

    e.       Plate 100ml of all the samples onto separate SOB agar containing 20mM MgSO4 with ampicillin and incubate at 37oC.

    Mini-preparation of pBR9 plasmid DNA by alkaline lysis with SDS (2ml)

    pBR9 mcherry Cr, mCherry Ds, tdTomato is isolated from small scale (2ml) bacterial cultures by treatment with alkaline and SDS

    a. Inoculate single colonies of transformed bacteria into 2ml of LB liquid medium contains ampicillin antibiotic. Incubate the culture overnight at 37oC with vigorous shaking.

    b. Pour 1.5ml of the culture into microfuge tubes. Centrifuge at maximum speed for 30 seconds at 4oC.

    c. Remove the medium by aspiration, leaving the bacterial pellet as dry as possible.

    d. Re-suspend the bacterial pellet in 100ml of ice-cold alkaline lysis solution I by vigorous vortexing.

    e. Add 200ml of freshly prepared alkaline lysis solution II to each bacterial suspension. Close the tube tightly, and mix the contents by inverting the tube rapidly five times. (Do not vortex it). Store the tubes on ice.

    f. Add 150ml of alkaline lysis solution III. Close the tube and disperse solution through the viscous bacterial lysate by inverting the tubes several times slowly. Store the tubes on ice for 3 minutes.

    g. Centrifuge the bacterial lysate at maximum speed for 5 minutes at 4oC in a microfuge. Transfer the supernatant to a fresh tube.

    h. Add an equal volume of phenol: chloroform. Mix the organic and aqueous phases by rotating for five minutes. Centrifuge

    Mini-preparation of pBR9 mCherry Cr plasmid DNA by alkaline lysis with SDS (100ml, 10ml X 10)

    Preparation of Cells:

    1. Plate out transformed colony on appropriate antibiotic plate. Incubate the plate overnight at 37oC.

    2. Inoculate single colony in 2 ml LB broth with appropriate antibiotic, incubate overnight at 37oC. Inoculate this culture to a final concentration of 1% in a fresh 100ml LB containing appropriate antibiotic. Incubate the culture 12-16 hrs at 37oC with vigorous shaking (200-220 rpm).

    3. Transfer the culture into two 50ml tubes and recover bacteria by centrifugation at 2500g for 10minutes at 4oC.

    4. Remove the media either by inverting the tube gently and placing the inverted tube on a tissue paper to drain off excess liquid or by gentle aspiration using a 10ml pipette, leaving bacterial pellet as dry as possible (either of the above method is chosen depending on the compactness of the pellet).

    Lysis of cells: (all steps below unless mentioned, should be on ice).

    5. Since each 10ml pellet needs to be re-suspended in 200ul of ice cold alkaline lysis solution I, Add 1ml to each 50ml tube and re-suspend the pellet by vigorous vortexing. Pool both into one of the 50ml tubes.

    6. Transfer 200ul of the suspension each to 10-11 microfuge tubes and store on ice.

    7. Do steps 7-9 for two tubes at a time: Add 400ul of freshly prepared alkaline lysis solution II at room temperature to each tube. Close the tube rapidly tight, and mix the contents by inverting the tube rapidly 5 times (with strong jerk motions, NO MORE than 5 times). Do not vortex. Make sure entire tube seems homogenous, and incubate the tubes at RT for 1-1:30 min (until the solution becomes clear/not turbid) and immediately transfer on ice for step 8.

    8. Add 300ul of alkaline lysis solution III to each. Close the tube and very slowly mix the viscous bacterial lysate by inverting and rotating the tube several times so that a single mass of precipitate forms. Store the tube on ice for 5 min or until step 9.

    9. Centrifuge the lysate at 16000g/10minutes at 4oC.

    10.Transfer the supernatant from tube 1 to a fresh tube and pool supernatant incrementally into the next tube after the previous one is full (from 10-11 tubes, at this step one should probably end up with about 6 completely full tubes).

    11. Mix the tubes by inverting and centrifuge the lysate at 16000g/5minutes at 4oC.

    12. Remove 1ml of supernatant from each into a fresh 2ml autoclaved tube and add 0.8ml of isopropanol and mix thoroughly by inverting. Incubate the tubes on ice (or -20oC) for 30 min to precipitate the DNA.

    13. Recover the precipitated DNA by centrifugation at 16000g/10minutes at 4oC.

    14. Discard the supernatant, and add 1ml of 70% ethanol to each tube. Flick the tubes hard with your fingers to dislodge the pellets and vortex for 20-30 secs to dissolve the salts.

    15. Recover the precipitated DNA by centrifugation at 16000g/10minutes at 4oC and discard the supernatant.

    16. Keeping the caps open, dry the pellet on a 37oC dry bath until the pellets look translucent and do not smell of any alcohol (over-drying the pellet at this stage will make it difficult for DNA to re-solubilize).

    17. Make a working stock of TE (pH 8.0) with 100ug/ml RNase and add 200ul to each tube. Incubate the tubes at 37oC for a total of 1-1:30 h. Keep tapping the pellet every 2-3 mins for the initial dissolution of DNA for up to 15 min (making sure that the entire pellet is completely dissolved).

    18. Make 125ul of a working stock of ProteinaseK (500 ug/ml) with 0.2% SDS and add 20ul of this mixture to each tube, incubate at 55oC (dry bath) for 1hr.

    19. Pool 3 tubes of this dissolved DNA into 1 tube (total two tubes) and add 500ul of freshly equilibrated PCI mix (pH 8.0) to each. Keep the tubes on a rotatory mixer at RT for 5 mins to make sure that the solutions are thoroughly mixed.

    20. Centrifugation the tubes at 16000g/10minutes at 4oC.

    21. Recover the supernatant into two fresh 1.5ml tubes (taking care not to touch or carryover the precipitate at the interphase).

    22. Add 500ul of Chloroform and keep the tubes on a rotatory mixer at RT for 5 mins.

    23. Centrifugation the tubes at 16000g/10minutes at 4oC and recover the supernatant into two fresh preweighed 1.5ml tubes.

    24. Based on the calculated volume of the solution, add 1/10th Volume of 3M NaAc and mix thoroughly before adding 0.8 Vol of isopropanol. Mix thoroughly by inverting. Incubate the tubes on ice (or -20oC) for 30 min to precipitate the DNA.

    25. Recover the precipitated DNA by centrifugation at 16000g/10minutes at 4oC.

    26. Discard the supernatant, and add 0.5ml of 70% ethanol to each tube. Flick the tubes hard with your fingers to dislodge the pellets and vortex for 20-30 secs to dissolve the salts.

    27. Recover the precipitated DNA by centrifugation at 16000g/10minutes at 4oC and discard the supernatant.

    28. Keeping the caps open, dry the pellet on a 37oC dry bath until the pellets look translucent and do not smell of any alcohol (over-drying the pellet at this stage will make it difficult for DNA to re-solubilize).

    29. Dissolve the pellets in about 200ul of TE (pH8.0) each, and incubate on a 37oC dry bath until completely dissolved (flick the tubes gently with your fingers occasionally to dislodge or dissolve the pellet). After complete dissolution, pool the DNA into one tube and store the plasmid DNA at -20 oC.

    30. Dilute 2ul of DNA sample with 18ul of TE (1:10 diln factor) and followed by another dilution step i.e. 2ul of previous dilution + 8 ul of TE (1:5 dilution).

    31. Calculate the A260 and 260:280 ratios for each of the DILUTED samples.

    32. Also analyse 2ul of each of the diluted samples on a 1% Agarose gel run in 0.5X TBE (at 5-7 V/cm). One does not need to run Molecular weight standards at this stage.

    33. Perform an RE digest with 0.3ug of plasmid/reaction to check for (i) plasmid map and (ii) linearization. Run 2.5ul of Lamda HindIII-EcoRI molecular weight standards for this gel.

    Restriction digestion of plasmid

    Analytic restriction digestion reaction of pBR9mcherry Cr was set up as follow Hind III digest:

    Restriction Digestion ofpBR9 mcherry Cr
    Components Volume
    1x NEB Cutsmart buffer 2.5ul
    Template (mcherry Cr plasmid) 5ul (58.73ng/ul)
    Nuclease free water 17.5 ul
    Hind III enzyme 0.2ml
    Total 25.2 ul

    The reaction mixture was kept at 370 for 1 hour. Thermal inactivation of Hind III was done at 60o for 20 minutes.

    Purification of extracted pBR9 mCherry Cr plasmid

    QIAquick Purification Using a Microcentrifuge

    This protocol is designed to purify single- or double-stranded DNA fragments by the QIAquick PCR & Gel Cleanup Kit. All centrifugation steps are carried out at 17,900 x g (13,000 rpm) in a conventional tabletop microcentrifuge at room temperature (15–25°C).

    Procedure

    1. Add 5 volumes of Buffer PB to 1 volume of the PCR sample, and then mix. It is not necessary to remove mineral oil or kerosene.

    2. If pH Indicator I has been added to Buffer PB, check that the mixture’s color is yellow.If the color of the mixture is orange or violet, add 10 μl of 3 M sodium acetate, pH 5.0, and mix. The color of the mixture will turn yellow.

    3. Place a QIAquick spin column in a provided 2 ml collection tube.

    4. To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.

    5. Discard flow-through. Place the QIAquick column back into the same tube. Collection tubes are reused to reduce plastic waste.

    6. To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.

    7. Discard flow-through and place the QIAquick column back into the same tube. Centrifuge the column for an additional 1 min.

    8. Place QIAquick column in a clean 1.5 ml microcentrifuge tube.

    9. To elute DNA, add 50 μl Buffer EB (10 mM Tris·Cl, pH 8.5) or water (pH 7.0–8.5) to the center of the QIAquick membrane and centrifuge the column for 1 min. Alternatively, for increased DNA concentration, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 5 min in the 370C water bath, and then centrifuge.

    10. If the purified DNA is to be analyzed on a gel, add 1 volume Loading Dye to 5 volumes of purified DNA. Mix the solution by pipetting it up and down before loading the gel.

    Gel excision and purification of pCC1G and intron region

    A pCC1G backbone plasmid, intron region were loaded in the 1%agarose gel and it is excised and purified by using the following Pure Link Quick gel extraction kit (Invitrogen DNA kit)

    1. Gel excision:

    a. Equilibrate a water bath to 500C

    b. Excise a minimal area of gel containing the DNA fragment of pCC1G and intron region with the sterile knife with help of UV lamp to visualize.

    c. Weigh the gel slice containing the DNA fragment using a scale sensitive to 0.001g.

    d. Add Gel solubilization buffer (L3) to the excised gel in the tube.

    e. Place the tube with the gel slice and buffer L3 into a 500C water bath. Incubate the tube at 500C for 10 minutes. Invert the tube every 3 minutes to mix and ensure gel dissolution.

    f. After the gel slice appears dissolved, incubate the tube for an additional 5 minutes.

    g. For optimal DNA yields, add 1 gel volume of isopropanol to the dissolved gel. Mix well.

    2. Gel purification:

    a. Load: Pipet the dissolved gel piece onto a Quick gel extraction column inside a wash tube. Use 1 column per 400mg of agarose gel.

    b. Bind: Centrifuge the column at 12000Xg for 1 minute. Discard the flow-through and place the column into the wash tube.

    c. Wash: Add 500ml of Wash buffer (W1) containing ethanol to the column.

    d. Remove buffer: Centrifuge the column at 12000Xg for 1 minute. Discard the flow-through and place the column into the wash tube.

    e. Remove ethanol: Centrifuge the column at maximum for 1-2 minutes. Discard the flow-through.

    f. Elute: Place the column into recovery tube. Add 50ml PCR water to the center of the column. Incubate the tube for 1 minute at room temperature.

    g. Collect: Centrifuge the tubes at 12000Xg for 1 minute.

    h. Store: The elution tube contains purified DNA stored at -200C.

    RESULT AND DISCUSSION

    Results

    Preparation of ultra-competent E.coli DH5 α\alpha cells

    Ultra-competent DH5 α\alpha cells prepared by Short Innoue protocol (refer method: 2.2.2). For that DH5a cells were revived form glycerol stock and purified to single colonies (Fig 2A). The DH5 α\alpha cells were tested on LB+ amp agar (Fig 2C) and LB agar plates (Fig 2B) for sensitivity to ampicillin. As expected, DH5 α\alpha cells grew profusely on the LB plate while no colonies grew on LB+ amp agar plate showing that the cells are not ampicillin resistant. The colony (B-2) which showed absolutely no background ampicillin resistance was selected for competent cell preparation (Fig 2D).

    DH5 α\alpha cells were inoculated in LB liquid media and then LB liquid culture were inoculated into SOB liquid media. The cells were re-suspended in sterlile transformation buffer (TB)and used for transformation. The remaining cells were flash frozen and stored in -800C after adding 7% DMSO.

    -2.png
      Streak plates E.coli DH5 α\alpha A. T-streak E.coli DH5 α\alpha from glycerol stocks B. Re-streak E.coli DH5  α\alpha C. Test background ampicillin resistance in 4 isolates. D. T-streak of quadrant no.2 which is sensitive to ampicillin

      Transformation of pBR9 plasmid in E.coli DH5a cells

      Ultra-competent DH5 α\alpha cells prepared were used for transformation by pBR9 mCherry Cr, mCherry Ds and tdTomato plasmids, by heat shock method (Ref Method: 2.2.2). The transformed cells were finally re-suspended in SOC. As control, untransformed competent cells were plated on SOB+ amp agar plates respectively to check for viability of the culture and background ampicillin resistance in the population prior to transformation, if any (Fig 3A). As a positive control, transformation efficiency was checked using 1ng of pCG plasmid (Fig 3B) and the test plasmids pBR9 mCherry Cr, mCherry Ds and tdTomato were transformed to clone the plasmid (refer fig.3 C-F). Using this, efficiency of the ultra-component cells in our experiment prepared by the short Innoue protocol was computed to be about:

      1.      tdTomato = 3.2X106 Cells/microgram of DNA.

      2.      pCG= 7.3X106 Cells/microgram of DNA

      Transformation efficiency = No. of colonies obtained on LB+ antibiotic plate ÷concentration of plasmid DNA used for transformation (mcg/ml)

      The efficiency of mCherry Cr, mCherry Ds are very low when comparing to tdTomato, pCG. To increase the chance of detecting transformants the mCherry Ds transformed mixture was centrifuged for concentration of the cells, and then inoculated (100ml and 400ml) in the SOBAmp+ agar plate. (refer: fig.3-E,F). After calculating transformation efficiency each transformed colony was streaked in the LB amp+ agar plates as four and two quadrant to get a single well isolated colony for further use.

      Since some of the transformants developed satellite (false positive) colonies, the transformants were isolated to single colonies by T-streaking . The negative control (competent cells without DNA) was used to compare and check the presence of any contamination . All controls were taken through every step of the transformation protocol which is followed for tests.

      -3.png
        Transformation of E.coli DH5a with plasmids containing Chlamydomonas Fluorescent protiens. A. Negative plasmid control B. Positive pCG plasmid control (2ng)
        C. tdTomato D. mCherry Cr E. mCherry Ds (100ul of transformation mix) F. mCherry Ds (400ul of transformation mix).

        Isolation of pBR9 plasmid (mCherry Cr, mCherry Ds and tdTomato) from transformants

        Plasmid extraction was carried out for 9 transformants, grown in LB+ amp liquid cultures, using alkaline lysis SDS mini-prep protocol (refer method :2.2.3). The potential pBR9 plasmids transformants for mCherry Cr, mCherry Ds and tdTomato were isolated (Fig 4A, B) and the extracted plasmids were analysed by restriction digestion followed by electrophoresis on a 1% agarose 0.5X TBE gel (Fig 4C). The plasmids were restricted by digestion with NcoI enzyme to analyze for release of insert (FP gene inserts: mCherry Cr 963bp, mCherry Ds 960, tdTomato 1683bp), to confirm the correct plasmids for further analyses. pBR9 mCherry Cr Clone 5 (fig.3C) was chosen for further experimentation.

        -4.png
          A. LB ampicillin agar plate with four quadrant of different colonies viz., mCherry Cr, tdTomato. B. Two quadrant of transformed mCherry Cr. C. Result of restriction digestion of extracted Plasmids (Mini-prep) with NcoI.

          Isolation by Midi-prep of pBR9 mCherry Cr plasmid from transformants

          A medium scale plasmid extraction was carried out for mCherry Cr, grown in 100ml LB+ amp

          liquid cultures, using alkaline lysis with SDS midi-prep (refer method: 2.3.4). The pBR9 mCherry Cr plasmid, was extracted and the isolated plasmid was analyzed by restriction digestion followed by electrophoresis of the products on a 1% agarose 0.5XTBE gel. The purified plasmid were analyzed in 1% agarose gel electrophoresis and the DNA was quantified by Image Lab 6.0 to check the concentration (compared to molecular weight standards)

          PCR and purification of the insert: mCherry Cr

          The extracted pBR9 mCherry Cr plasmid was used as template for PCR using the designed primers, and Q5 high fidelity thermostable DNA polymerase. The resulting amplicon was electrophorsed on an agarose gel and the exact 963bp band was purified by gel excision followed by extraction using the QIAquick spin handbook protocol (Fig 5, refer method: 2.2.7).

          3.3.5.png
          • 1
          Excised gel for purification of pBR9 mCherry Cr amplicon

          Purification of cloning backbone plasmid: pCC1G

          The pCC1G plasmid is backbone plasmid into which the mCherry Cr was to be cloned. pCC1G was restriction digested by Ndel, Xbal. The expected result was a band with ~6 and 4 kb. We needed the 6kb plasmid backbone purified while 4kb containing UTR to GFP was to be discarded. The 100ul of entire sample was loaded in the fused well in 1% agarose gel for gel extraction of the ~6kb plasmid backbone (Fig 6). The gel band was excised and purified by using Invitrogen gel purification DNA kit (refer method: 2.2.7).

          -3.3.6-3.png
            Excised gel for purification of pCC1G plasmid

            Purification of second insert: Intron region

            The Intron region was PCR amplified using the designed primers, and the exact expected 151bp band was gel purified (2% agarose 0.5X TBE gel) by using the Invitrogen DNA kit (Fig 7, refer method: 2.2.7).

            3.3.7-1.png
              Excised gel for purification of  intron region 

              CONCLUSION AND DISCUSSION

              We transformed and isolated the pCC1G plasmid and purified the cloning backbone RNAi3 plasmid by restriction digestion and gel purification (Fig 6). The inserts to be cloned, namely the 151bp intron region followed by the fluorescent protein gene template (mCherry Cr) were PCR amplified by designed primers that had compatible restriction sites essential for the development of new pCiG plasmid. Once ligated and cloned successfully this new design is expected to express fluorescent protein in the green microalga Chlamydomonas along with antibiotic resistance to Paromomycin. The pCC1G backbone template and insterts (intron+mCherry Cr) were excised and purified. These are now ready to be ligated with each other by T4 DNA ligase to form pCiG plasmid. Then the pCiG plasmid will transformed into DH5alpha E.coli cells ultra-competent cells to clone the ligated plasmid

              clone the II. Growth Curve Experiment

              we studied the effect of metal ion stress on C.reinhardtii (cc124 wild type), cells were grown under excess Zn and/or Cu concentrations. Stress usually leads to a slow down of the growth rate and/or formation of clusters of Chlamydomonas called palmelloids. Our hypothesis being that, if these phenotypes are epigenetic, they can be interfered by a specific epigenetic inhibitor. We wanted to test the role of Polycomb, if any, in this stress paradigm, previously tested with a range of transition metals which are known to create oxidative stress in other model systems. To begin with, we recorded the growth curve by comparing C.reinhardtii under two growth conditions; -Mn control media, and 2X Zn + 3X Cu test media where the 'X' refers to a fold-excess of concentration compared to that in normal TAP growth media. These control conditions were compared to the test experiment grown in the presence of GSK343 polycomb inhibitor. The inhibitor was specifically desgined against the human Polycomb protein EZH2, whose homologue is conserved (in sequence and predicted domains) in Chlamydomonas. A range of inhibitor concentrations between 2-10uM has been shown to be effective in Human cell lines, hence we used 10uM GSK343 for the expriment.. Essentially, during this experiment the total number of cells and the number of cell clusters (stressed Chlamydomonas) were counted at regular intervals (every 4h) by using hemocytometer. Finally the values were plotted as cell density against time giving us a growth curve (Fig 8).

              3.3.9-1_1.png
                Growth curve of Chlamydomonas cc124 wildtype

                Our observations showed that the overall growth rate (slope of the curve) was similar under all conditions, proving two points; (i) the stress conditions (2X Zn, 3X Cu) were not slowing the growth of the Chlamydomonas cells, compared to the control (1X1X), and (ii) the human Polycomb inhibitor added was either not toxic to the cells, or ineffective in Chlamydomonas at 10uM (Fig 8). We also did not observe any change in cell clumps as a function of either stress or inhibitor added, further supporting the above inferences. It now remains to be seen, if the cells do show epigenetic phenotypes and if the inhibitor at these non-toxic conditions is active.

                Conclusion: (A) The cloning plasmid backbone of RNAi3 was purified by excision of the insert from pCC1G. In parallel the two inserts namely, intron sequence and mCherry Cr were PCR amplified and gel purified for cloning. (B) The Human Polycomb inhibitor GSK343, seems to be non toxic to Chlamydomonas vegetative cells both under normal growth conditions as well as metal ion stress conditions.

                3.3.8-1.png
                  Chlamydomonas reinhardtii under microscope (40x)

                  REFERENCES

                  • Beth A.Rasala et.al, 2013. Expanding the spectral palette of fluorescent protein for the green alga Chlamydomonas reinhartti. The plant journal (2013) 74,545-556.
                  • Fuhrmann M, Oertel W, Hegemann P. A synthetic gene coding for the green fluorescent protein (GFP) is a versatile reporter in Chlamydomonas reinhardtii. Plant J. 1999 Aug;19(3):353-61. PubMed PMID: 10476082
                  • H Cerutti, A M Johnson, N W Gillham, J E Boynton,June 1997.Epigenetic silencing of a foreign gene in nuclear transformants of Chlamydomonas. The plant cell, The American Society of Plant Biologists.
                  • Harris, E.H., Stern, D.B. and Witman, G.B. (eds) (2009) The Chlamydomonas Sourcebook, 2nd edn. Oxford: Academic Press.
                  • Joseph Sambrook, David W. Russell. The Inoue Method for Preparation and Transformation of Competent E. coli: "Ultra Competent" Cells. Molecular Cloning: A Laboratory Manual Third Edition.
                  • Merchant et al., 2007 The Chlamydomonas genome reveals the evolution of key animal and plant functions.Science. 2007 Oct 12; 318 (5848):245-50. PubMed PMID: 17932292; PubMed Central PMCID: PMC2875087.
                  • Mustafa J Motiwalla, Marilyn P Sequeira and Jacinta S D'Souza, 2014. Two Calcium-Dependent Protein Kinases from Chlamydomonas reinhardtii are transcriptionally regulated by nutrient starvation.Plant signaling and behaviour.
                  • Sarah C.R. Elgin and Gunter Reuter, 2013 Position-Effect Variegation, Heterochromatin Formation, and Gene Silencing in Drosophila, Cold Spring Harbor Laboratory Press.
                  • Sambrook J,Fritsch E.F and Maniatis T.1989. Molecular cloning: A Laboratory Manual. 2nd Edition, Cold spring Harbour Laboratory press, Cold Spring Harbour, New York.
                  • Victoria Lumbreras, Saul Purton, Recent Advances in Chlamydomonas Transgenics, Protist,Volume 149, Issue 1,1998,Pages 23-27,ISSN 1434-4610.

                  FUNDING SOURCES

                  We wish to thank funding from the Ramalingaswami Re-entry Fellowship, Dept. of Biotechnology, India provided to Subhojit Sen (2013-2020) and UM-DAE Centre for Excellence in Basic Sciences, Mumbai University, Kalina Campus, Santacruz East, Mumbai 400098.

                  ACKNOWLEDGEMENTS

                  Inspiration and motivation have always plays a key role in the success of any venture.

                  I am grateful to Science Academies’ summer research fellowship programme-2019 and Chairman, Coordinator of Science Education panel, Indian Academy of Sciences who gave me a fruitful opportunity to work under the Summer Research Fellowship programme-2019.

                  I express my sincere gratitude to Dr. Subhojit Sen, Ramalingasamy Fellow, School of Biological sciences, UM-DAE Centre for Excellence in Basic Sciences, for providing me a great opportunity to carry out this project under his guidance, support and most valuable suggestions.

                  I would also like to acknowledge the Department of Biological Sciences, Centre for Excellence in Basic Sciences, University of Mumbai.

                  I owe a deep sense of gratitude to my beloved colleague Shital Bhanushali, Junior project assistant. She act as a mentor during my work. And also my gratitude to Sen Lab members-Aishwarya Iyer, Mohit virdi, Shyam D Nair, Neelima PV, Jay phadke, Abinav, Anouskha, Rakshitha and Rahul for your kind support.

                  I would also like to acknowledge my Principal, Head of the Department and faculties of PG & Research Department of Zoology, Vivekananda College, Tiruvedakam-West, Madurai, Tamil Nadu.

                  More
                  Written, reviewed, revised, proofed and published with