Loading...

Summer Research Fellowship Programme of India's Science Academies

Cloning of human microRNA (miR-631) in mammalian expression vector

Riddhi Girdhar Agarwal

Department of Biochemistry, All India Institute of Medical Sciences, Jodhpur, Rajasthan, 342005

Prof. Arun Kumar

Department of Molecular Reproduction, Development and Genetics, Indian Institute of Science, Banglore, 560012

Abstract

MicroRNAs (miRNAs) are small regulatory RNAs, which are known to play a major role in posttranscriptional regulation of genes. The biogenesis of miRNAs starts with transcription of genes into primary miRNA molecules, which are then processed in nucleus and cytoplasm, by the endoribonucleases, to finally give rise to mature miRNAs. These miRNAs are relatively conserved in eukaryotes and exert their gene regulatory functions through degradation or translational repression of target mRNAs by binding to their 3’-Untranslated region (UTR). The abberant expression of miRNAs (both upregulation and downregulation) has been reported to be involved in the pathogenesis of many human diseases specially cancer, with nearly 50% of miRNAs known to be associated with tumorigenesis. However, our understanding of the conditions under which these miRNA affect various biological pathways and pathological conditions is limited. At present, these small stretches of nucleotides are not only giving new directions to research but are also being instrumental in new drug discoveries. In this study, the techniques for cloning a miRNA into a host bacterial cell have been described, which is a pre-requisite for any in vitro study that is done to understand the role of aberrant miRNA expression and its effect in any biological pathway.

Keywords or phrases: silencing of target mRNA, microfactories of nucleic acids

Abbreviations

AGOmicro RNA
BTZprimary miRNA
DGCR8 DiGeorge syndrome critical region 8
 PC Prostate Cancer 
 PCRPolymerase Chain Reaction 
 RDT Recombinant DNA Technology
 RISC RNA-induced Silencing Complex
 UTRUntranslated Region 
 XPO5Exportin 5 

INTRODUCTION

MicroRNA

MicroRNAs (miRNAs) are a class of single stranded, noncoding, endogenous RNAs which are expressed in a large number of animal and plant species. Out of all the predicted human genes, miRNAs (~ 1000 genes) account for nearly 1-5% of the total genes (​​Bartel DP, 2004​​). The first miRNA to be discovered was lin-4, in 1993, in Caenorhabditis elegans by Ambros and Ruvkun groups (​Victor Ambros, 1993​). This discovery has ever since revolutionized the field of molecular biology by opening a tremendous interest in the field of miRNAs, their biogenesis, regulatory roles and involvement in various biological pathways (​​ ​Pillai RS, 2005​ ). Genome-wide identification and computational analysis has revealed that each miRNA can bind to hundreds of different target mRNAs, which cumulatively accounts for regulation of about 30% of the protein coding genes in humans ( ​Friedman RC and Farh KK and Burge CB and Bartel DP, 2009​ ). New miRNAs are still being discovered and their roles in gene regulation are being correlated with the etiology, classification, progression and prognosis of various human diseases such as cancer, cardiovascular diseases, inflammatory diseases, autoimmune diseases etc (​​Ardekani AM and Naeini MM, 2010​​).

Biogenesis of miRNA

miRNAs regulate post-transcriptional gene expression by RNA silencing in a wide range of eukaryotic organisms and viruses ( Bartel DP, 2004 ). Mostly miRNAs are processed through canonical pathway which starts with transcription of primary miRNA (pri-miRNAs) in nucleus. The pri-miRNAs are at times are even more than 1000 nucleotide in length and contain a sequence of around 22 nucleotides of mature miRNA ( Denli AM and Tops BB and Plasterk RH and Ketting RF and Hannon GJ, 2004 ). The processing of pri-miRNA transcript into mature miRNA is carried out by RNA polymerase either RNA Polymerase II/III ​(Fig 1​). The pri-miRNAs transcripts have a double-stranded hairpin like structure which usually consists of 60-120 nucleotides along with 5’ and 3’ overhangs ( Han J and Lee Y and Yeom KH and Nam JW and Heo I and Rhee JK and Sohn SY and Cho Y and Zhang BT and Kim VN, 2006 ). These features of pri-miRNA stucture, are essential for recognition of pri-miRNA by RNA binding protein DiGeorge Syndrome Critical Region 8 (DGCR8), which recognizes a conserved N6-methyladenylated GGAC in pri-miRNA. The other motifs within the pri-miRNA are recognised by double-strand-specific ribonuclease, Drosha. Together DGCR8 and Dorsha form a micro-processor complex for processing of pri-miRNA into pre miRNA ( O'Brien J and Hayder H and Zayed Y and Peng C, 2018 ). Within the micro-processor complex, the pri-miRNA duplex is then cleaved by Drosha at the base of the hairpin structure of pri-miRNA, which results in the formation of a 2 nt 3′ overhang on pre-miRNA within the nucleus ( Okada C and Yamashita E and Lee SJ and Shibata S and Katahira J and Nakagawa A and Yoneda Y and Tsukihara T, 2009 ). After this the pre-miRNAs are translocated into the cytoplasm via exportin 5 (XPO5) and it’s partner RanGTP marking the end of nuclear phase (​Fig 1​). In the cytoplasm pre-miRNAs bind to DICER (RNase III endonuclease), which cleaves the loop region of pre-miRNA hairpin and releases a duplex miRNA consisting of nearly 22 nucleotides ( John J. Rossi, 2017). The duplex miRNA consists of a guide strand which gets loaded into RNA-induced silencing complex (RISC), that constitutes of argonaute (AGO) proteins. The unloaded strand of duplex miRNA, called as the passenger strand, is unwound from the guide strand through various mechanisms based on the degree of complementarity and is later degraded ( Yoda M and Kawamata T and Paroo Z and Ye X and Iwasaki S and Liu Q and Tomari Y, 2010). The miRISC complex formed with association of miRNA and RISC assists the miRNA in finding complementary sequence within the target mRNA. Upon binding, the miRNA can either degrade the target mRNA or inhibit its translation.

miRNA image.png
    : Biogenesis of miRNA- miRNAs are transcribed by RNA Polymerase into primary miRNA transcripts which are processed by microprocessor complex (Dorsha and DGCR8) into Pre-miRNA in the nucleus. The pre-miRNA is then transported through XPO 5 into the cytoplasm where DICER, a ribo endonuclease cleaves the loop of hairpin like structure of pre-miRNA. One of the strand of the duplex miRNA hence generated gets loaded on to RISC and the unloaded stranded is degraded. The RISC facilitates in binding of miRNA to the target mRNA, which either gets translationally suppressed or degraded upon miRNA binding.  (​Lin S and Gregory RI, 2015​ )

    Functions of miRNA:

    Many reports suggest that miRNAs are involved in various biological processes like hematopoietic lineage differentiation, host pathogen interactions, apoptosis, embryo development, differentiation, organ development, proliferation, signal transduction and tumorigenesis have been unveiled ( ​Guarnieri DJ and DiLeone RJ, 2008​ ). They have also been linked to several aspects of neuronal functions including developmental remodelling, spine development and post-mitotic neuron cell survival (​Rajman M and Schratt G, 2017​). Gene expression profiling studies have demonstrated alterations in miRNA expression in a wide range of human disease and therefore these findings emphasise a greater potential of these miRNAs for clinical diagnostics. The abnormal expression of miRNAs (both upregulation and downregulation) has been reported to be involved in the pathogenesis of many human cancers where, nearly 50% of miRNAs are known to be associated with tumorigenesis. Studies have also linked miRNA dysregulation as a casual factor in many diseases ( ​Kreth S and Hübner M and Hinske LC, 2018​) therefore, more efforts are being put to develop therapeutics that directly target the miRNA, wherein the disease related miRNA expression can be either inhibited or restored to maintain the homeostasis of the cell.

    Recombinant DNA Technology

    Recombinant DNA is the DNA that is formed by combination of genetic material from at least two different sources, which results in a chimeric DNA sequence that is otherwise not found in any genome. Recombinant DNA Technology (RDT) is based upon usage of restriction enzymes which are bacterial enzymes that degrade foreign viral DNA molecules and hence restrict their function within bacterial cells ( ​Venter M, 2007​ ). However in RDT these enzymes have been used to a good advantage to “cut” and “paste” DNA molecules and create recombinant DNA molecules. This technique is based on the fact that, all organisms share the same chemical structure of nucleotides and bonds between them, they only differ in the arrangement of nucleotide sequence which makes the genome of an individual organism, thus it is possible to link nucleotides of two unrelated species into a single molecule. RDT has been used to artificially ligate a particular “gene of interest” into a vector DNA molecule (such as plasmids), which can be inserted into another cell and is capable of independent replication and/or expression within it ( ​Khan S and Ullah MW and Siddique R and Nabi G and Manan S and Yousaf M and Hou H, 2016​ ). Today, RDT has been instrumental in production of biopharmaceuticals (human insulin, which was the first drugs to be produced by medical biotechnology) and in gene therapy (replacement of defective genes) which is contributing significantly in health care ( ​Cederbaum SD and Fareed GC and Lovett MA and Shapiro LJ, 1984​ ).

    LITERATURE REVIEW

    miR-631: the known and unknown facts

    Mir-631 was first identified in human colorectal tissues ( ​Cummins JM and He Y and Leary RJ and Pagliarini R and Diaz LA and Sjoblom T and Barad O and Bentwich Z and Szafranska AE and Labourier E and Raymond CK and Roberts BS and Juhl H and Kinzler KW and Vogelstein B and Velculescu VE, 2006​ ). Later, miR-631 was reported to be associated with increased risk of esophageal cancer ( ​Ye Y and Wang KK and Gu J and Yang H and Lin J and Ajani JA and Wu X, 2008​ ​Ye Y and Wang KK and Gu J and Yang H and Lin J and Ajani JA and Wu X, 2008​ ). In a research done to study the effects of common sequence variations in genes of miRNA in Renal Cell Carcinoma, it was found that a Single Nucleotide Polymorphism (rs5745925) in mir631 was associated with increased risk of Renal Cell Carcinoma recurrence ( ​Lin J and Horikawa Y and Tamboli P and Clague J and Wood CG and Wu X, 2010​ ).

    In another study, multiple myeloma (MM), which is a cancer that affects the plasma cells of immune system, is usually treated by chemotherapy based on administration of bortezomib (BTZ), an anti-cancer drug ( ​Nicola Giuliani, 2015​ ), initial chemotherapeutic treatments were reported to lapse due to acquired resistance for BTZ( ​B. Barlogie, 2004​). Therefore, further research was done to determine mRNA and protein expression levels of UbcH10 (an enzyme which has the ability to promote cell growth and malignant transformation of various cells) in the BTZ-resistant cell lines ( ​Okamoto Y and Ozaki T and Miyazaki K and Aoyama M and Miyazaki M and Nakagawara A, 2003​ ). It was found that hsa-miR-631 was able to bind to UbcH10-3'UTR and therefore it post-transcriptionally regulated UbcH10( ​Xi H and Li L and Du J and An R and Fan R and Lu J and Wu YX and Wu SX and Hou J and Zhao LM, 2017​ ). Further, a forced overexpression of miR-631 in myeloma cells increased their sensitivity to BTZ, and thus miR-631 was suggested to serve as a biomarker in treatment of MM ( ​Xi H and Li L and Du J and An R and Fan R and Lu J and Wu YX and Wu SX and Hou J and Zhao LM, 2017​ ).

    The role of miR-631 in the pathogenesis of prostate cancer (PC), which is the one of the most prevalent cancer in men has also been studied . They show that miR-631 was found to be downregulated in PC cell lines and tissues where it targets the 3’-UTR of ZAP70 mRNA (ZAP70 is a 70 kDa tyrosine kinase) which is involved in cell migration and invasion of PC cells ( ​Richardson SJ and Matthews C and Catherwood MA and Alexander HD and Carey BS and Farrugia J and Gardiner A and Mould S and Oscier D and Copplestone JA and Prentice AG, 2006​ ).

    These findings are concordant with the theory that a single miRNA can have diverse roles in different tissues, as it can be seen that miR-631 is involved in the pathogenesis of esophageal cancer and renal cell carcinoma and it can also serves as a potential therapeutic option in treatment of multiple myeloma and prostate cancer with further advancement. Apart from these handful reports on the role of miR-631 in human tissues, it is also expressed in all the other major tissues as well (​​Fig 2​​). Since the studies done so far have been in light of few cancers, and its role in oral cancer is not known we wanted to assess the role of miR-631 in oral cancer.

    miR-631 in human tissues.png
      The mRNA expression of miR-631 Gene in normal human tissues, as obtained from GTExIllumina and BioGPS  [Image from miR-631 gene cards , https://www.genecards.org/cgi-bin/carddisp.pl?gene=MIR631#expression]

      Objectives of the Research

      • To clone hsa-miR-631 in a mammalian expression vector pcDNA3-EGFP.

      METHODOLOGY

      The bacterial cell culture work was performed under sterile conditions in a laminar hood. Glass and plastic wares were autoclaved prior to their usage. Culture media, solutions and supplements were sterilised by autoclaving. The hood was cleaned by ethanol and exposed to UV light before and after every use.

      Bacterial Cell culture

      Bacterial strain:

      The DH5α strain of E.coli (Escherichia coli) was used for cloning purpose, as the DH5α strain is easy to transform, deficient in recombination and amber suppressing. It also pemits α-complemntation with the amino terminus of β-galactosidase encoded by a appropriate vector thus providing a useful feature of the blue white screening.

      Media preparation for bacterial cultures:

      Luria-Bertani (LB) broth (2gm/100ml) was used for bacterial culture. LB agar plate was prepared using LB broth and 1.5% (w/v) bacteriological agar. All media, solutions and supplements used in the bacterial culture work were sterilised by autoclaving. The molten LB agar was cooled to around 50˚C before adding ampicillin at a final concentration of 100µg/ml. The LB agar was then poured in 90mm bacteriological plates in a laminar hood and allowed to solidify prior to use.

      Preparation of competent cells using CaCl2 :

      In order to prepare competent cells, E. coli DH5α strain was streaked on a LB agar plate and incubated overnight at 37 ˚C (​Fig 7​). A single bacterial colony was then inoculated in 5 ml of sterile LB broth in a 50 ml falcon. In an incubator set at 200rpm and 37˚C the tube was incubated overnight (16hr). A 500ml conical flask containing 60 ml of sterile LB broth, was used to inoculate 1% of overnight grown culture. In order to allow the culture to grow the flask was incubated for 2-3hr at 37˚C till the OD600 was found to be between 0.4-0.6. The obtained culture was then chilled on ice for 20 min and then centrifuged at 4000 rpm at 4˚C for 15 min. The cell pellet was then resuspended in 30ml of sterile and ice cold 100mM CaCl2 . The tube was then stored on ice for 30 min. After 30 mins the tube was centrifuged at 4000 rpm at 4˚C for 15min and then then pellet formed was resuspended in 1.8 ml of 100mM ice cold CaCl2. The pellet hence obtained was then dislodged and resuspended by aspirating with a pipette. The cell suspension was then incubated at 4˚C for 4 hr. The competent cells formed were aliquoted (100µl/tube) and then supplemented with 40 µl of glycerol and stored at -80˚C until future use.

      Analysis of Efficiency of Competent cells:

      The prepared competent DH5α cells were transformed with pcDNA3-EGFP plasmid, which is a mammalian expression vector and confers ampicillin resistance to the transformed cell. Appropriate amount (10 ng) of plasmid DNA was added to 100 µl of competent cells, the contents were then incubated on ice for 30 min. The cells were then subjected to heat shock at 42˚C for 90 mins and then snap chilled for 3 minutes. 1ml of LB was added to the cells and then they were incubated at 37˚C at 200 rpm for 1 hr. The cells were then spread onto a sterile ampicillin containing LB-agar plate and then incubated overnight at 37˚C to allow bacteria to grow​​ (​Fig 8a​​, ​​​Fig 8b​)​.

      Amplification of gene of interest

      Gene of interest: MIR631

               Genomic Location of miR-631 : 15q24.2

      Chromosome 15 - NC_000015.10

      chromosomal location of miR-631.png
        Chromosomal location of miR-631 Gene as obtained miR-631 gene cards, [https://www.genecards.org/cgi-bin/carddisp.pl?gene=MIR631#expression] The bands in the image are according to Ensembl, and the locations according to GeneLoc

               Genomic Sequence of miR-631

        >NR_030360.1 Homo sapiens micrNA 631 (MIR631), microRNA

        GTGGGGAGCCTGGTTAGACCTGGCCCAGACCTCAGCTACACAAGCTGATGGACTGAGTCAGGGGCCACACTCTCC

        Sequence of miR-631 as obtained from NCBI Nucleotide Database [https://www.ncbi.nlm.nih.gov/nuccore/NR_030360.1?report=fasta]

        Primer designing to amplify miR-631:

        The gene of interest was searched in National Center for Biotechnology Information (NCBI) Database and from NCBI Reference Sequences of miR-631 RNA sequence (NR_030360.1) was selected. In the LinkOut to external resources menu the option of UCSC Genome Browser was clicked, on the page redirected to UCSC genome browser, the link of NCBI RefSeq genes, was used to reach Human Genome Assembly. The in the tool bar options from the ‘view’ dropdown menu DNA was selected and in the Sequence Retrieval Region Option a sequence of 500 bp upstream and 500 bp downstream was added to ‘get DNA’.

        miR-631 DNA sequence.png
          The miR-631 coding DNA sequence showing 500bp upstream and 500bp downstream sequences from the stem loop region of miR-631 (highlighted in red)

          In order to obtain primers for amplification of miR-631, 200 bp upstream and downstream of the target gene sequence was screened to get specific forward and reverse primers respectively in NCBI primer BLAST. In order to amplify the gene of interest (miR-631 DNA sequence) in vitro, Polymerase Chain Reaction (PCR) was carried out with commercially synthesised primers which had restriction sites of enzymes Hind III (Forward primer) and XhoI (Reverse primer), for the ease of ligation into vector plasmid.

          restriction sites on primers.png
            The forward (F) and Reverse (R) primers used for amplification of miR-631 DNA sequence.

            Template DNA amplification by PCR:

            The amplification of gene of interest was carried out in automated and temperature controlled cycles of denaturation, annealing and elongation using a PCR machine/ thermal cycler. The thermal cycle parameters were set as follows:

            The thermal cycle parameters set for amplification of miR-631 DNA sequence
            Steps Temperature Time Cycles
            Initial Denaturation 95 5 min 1
            Denaturation 95 30 sec 35
            Annealing 56 30 sec 35
            Extension 72 30 sec 35
            Final extension 72 10 min 1
            Hold 4 - -
            Reaction Protocol followed for carrying out PCR
            Reagents Test (with template DNA) Control (without template DNA)
            PCR water 13.55 µl 14.55 µl
            Buffer 2.5µl 2.5 µl
            MgCl2 0.75 µl 0.75 µl
            dNTP 5 µl 5 µl
            Fwd primer 1 µl 1 µl
            Reverse primer 1 µl 1 µl
            Template (miR-631) 1 µl -
            Polymerase (taq) 0.2 µl 0.2 µl

            Total Volume 25 μl

            After amplification 5 μl xylene cyanol was added to the PCR tubes and the whole volume was then run in 1.5% of agarose gel containing Ethidium Bromide and visulaised by a UV-transilluminator.

            Agarose Gel Electrophoresis:

            Agarose Gel Electrophoresis was used to analyze the quality of the amplified PCR product and vector. DNA being negatively charged runs from negative terminal towards positive terminal in an applied electric field and ethidium bromide (a nucleic acid stain that intercalates into DNA and can be visualised using a UV-transilluminator) . 1X TAE buffer (40mM Tris –HCl, 20mM acetic acid, 1mM EDTA, pH 8.0) containing 0.25µg/ml of ethidum bromide was used to prepare 1% Agarose gel. The DNA sample was mixed with 5µl of gel loading dye (50% glycerol and 0.5% bromophenol blue in TE buffer) and was then loaded onto the gel and 1X TAE buffer was used to run the samples at a constant voltage (80-100V). The gel was then visualised on a UV-transilluminator and photographed using Gel Documentation system.
            ​(​Fig 10​​).

            Recovery of DNA from agarose gels:

            The digested insert (miR-631) and vector (pcDNA3-EGFP) were recovered from Ethidium bromide stained agarose gel using Genelute TM Gel extraction Kit (Sigma-Aldrich, USA), as per the manufacturer’s instructions. The kit constitutes of silica binding technology with spin or vaccum column. The band was cut using a scalpel while visualizing the band on a UV transilluminator. The cut agarose gel piece was weighed and dissolved in 3 volumes of gel solubilisation buffer and then incubated at 50˚C for 10 min. Once the gel piece was completely solubilised, 1 gel volume of isopropanol was added to the homogenous mixture to precipitate out DNA. A DNA column that was pre-treated was then loaded with the homogenous mixture and centrifuged at 12,000 rpm at room temperature for 10 min. The flow through was discarded and the column was washed with wash buffer containing alcohol. The column was then given an empty spin and the residual volume was discarded. DNA was eluted from the column in 20 µl of TE buffer and stored at -20˚C for future use.

            Quantification of DNA by spectrophotometry:

            The absorption maxima of DNA lie at the wavelength of 260 nm. The DNA samples (vector and insert) were quantitated using spectrophotometric analysis, and the TE buffer was used as blank. Absorbance value (O.D) of 1 at 260 nm = 50 µg of double-stranded DNA. Concentration of double-stranded DNA in µg/ml was measured using the formula.

            O.D. at 260nm x Dilution Factor (500) x 50/1000

            Construction of Recombinant DNA

            Restriction digestion of DNA:

            In order to digest vector (pcDNA3-EGFP) and amplified PCR product (miR-631) the restriction digestion was carried out in a 20µl volume containing 0.5-1 µg of template DNA, 1X digestion buffer and 10U of HindIII and XhoI restriction enzymes. The above mixture was incubated at 37˚C overnight.

            pcDNA-3EGFP_1.png
              Full Sequence Map for pcDNA3-EGFP plasmid, with Restriction sites for HindIII and XhoI encircled. [Image obtained from https://www.addgene.org/13031/]

              Ligation Reaction:

              The double digested insert and vector were run on 1.5 % agarose gel and purified by Genelute TM Gel extraction Kit (Sigma-Aldrich, USA). The eluted vector and pcr product were quantitated by spectrophotometric method and was used to set up ligation reaction, with vector to insert molar ratio of 1:3. The total volume of ligation reaction was 10 µl with 5% PEG-4000, 1X ligation buffer and 1U of T4 DNA ligase. The reaction was carried out at 16˚C for 16 hr.

              Introduction of Recombinant DNA into host

              Transformation of DH5α cells:

              Three separate E coli DH5 α cells aliquots (100µl ) were transformed with double digested pcDNA3-EGFP plasmid with ligase (​​Fig 11a​)​​, the ligated pcDNA3-EGFP + miR-631 (Vector + Insert) (​Fig 11b​) ​​and uncut pcDNA3-EGFP plasmid (Vector alone) (​Fig 11c​​), to serve as negative control, test and positive control respectively, for studying efficiency of insert ligation and cloning in vector plasmid, using the protocol previously followed to transform E.coli DH5 α cells.

              Preparation of glycerol stocks:

              A single isolated colony of bacteria was inoculated in 5 ml LB and kept in an incubator at 37˚C at 200 rpm overnight for the bacteria to grow. Next day, Fifty percent glycerol was prepared and autoclaved. 500µl of freshly grown culture was aliquotted (inoculated from a single isolated colony) was mixed with 200µl of 50% glycerol and was immediately placed on ice and then stored at -80˚C. The remaining overnight grown culture (4500 µl) was used for plasmid isolation.

              Screening of clones with the desired insert miR-631:

              Plasmid isolation using alkaline lysis method:

              A single bacterial colony was inoculated in 5 ml of LB broth with 100µg/ml of ampicillin and incubated overnight at 37˚C at 200 rpm overnight. Next day the culture was pelleted down by centrifuging at 5000 rpm for 10 minutes at 4˚C. 150 µl of resuspension solution (Solution 1: 50mM Sucrose, 10mM EDTA and 25mM Tris pH 8) was added to the pellet for resuspension. After 2 minutes the pellet was dissolved by vortexing and 200 µl of freshly prepared lysis solution (Solution 2: PCR water, 0.2N NaOH, 10% SDS) was added to the tube. The contents were mixed by inverting it slowly 2-3 times, the tube was then kept for 3 minutes till the solution became clear. 200 µl of neutralisation solution (Solution 3: 3M sodium acetate, pH 4.8) was added and the tube was then incubated on ice for 5 minutes. The contents of tube were centrifuged at 12000 rpm for 20 minutes at 4˚C and the supernatant obtained was transferred to fresh 1.5ml tube, while avoiding the contact of pipette tip with the pellet formed. 10 µl RNAse A (10mg/mlstock) was added and the tube was incubated at 37˚C for 2-3 hrs. The proteins were removed by chloroform density separation, wherein 200 μl of chloroform was added to the tube and then centrifuged at 12000rpm for 15min at 4˚C.The upper aqueous phase was transferred to a fresh 1.5 ml tube and the above step of chloroform density separation was repeated. The obtained aqueous layer was again transferred into a 1.5 ml tube and 1 ml of isopropanol was added and the tube was then centrifuged at 12000rpm for 10 min at 4˚C. To the pellet 1 ml of 70% chilled ethanol was added and the tubes were centrifuged at 12000rpm for 5 min at 4˚C. Supernatant was decanted and the pellet was air dried and 20 μl of warm TE (tris EDTA) buffer was added to the tubes. 2 μl of sample was mixed with 3 μl of loading dye and were resolved on 1% agarose gel to check the quality of the plasmid.

              Restriction digestion of recombinant vector:

              The isolated plasmids were double digested using the enzymes HindIII and XhoI, following the same protocol that was previously used to create restriction sites in vector (pcDNA3-EGFP) and insert DNA (miR-631). The double digested product was then resolved on 1.25% agarose gel and viewed under UV transilluminator to check the insert release (​​Fig 12​​).

              Isolation of plasmid DNA for sequencing:

              In order to sequence the recombinant plasmid, the positive clones were streaked from their glycerol stock and incubated at 37˚C for 12-14 hrs. Next day a single colony was inoculated in 5 ml LB broth containing 100 µg/ml of ampicillin and allowed to grow overnight at 37˚C at 200 rpm. The following day cells were pelleted by centrifuging at 4000rpm for 10 minutes. The pelleted cells were used for plasmid DNA isolation using GenEluteTM Plasmmid Miniprep Kit (Sigma-Aldrich, USA) according to the manufacturer’s instructions. The isolated plasmid DNA was quantified using spectrophotometric method as described previously. A sample with 100ng/µl concentration of DNA was then sent for sequencing.

              RESULTS AND DISCUSSION

              streaking DH5.png
                Image of LA plate bearing colonies of streaked E coli DH5α cells 
                Transformed Ecoli DH5.png
                Lawn of colonies of E coli DH5α cells transformed with pcDNA3-EGFP
                  untranformed E.coli DH5.png
                  Absence of any colonies of untransformed E coli DH5α cells.
                    The E coli cells were grown in ampicillin antibiotic containing medium. Bacterial colonies can be seen in only transformed cells due to ampicillin resisitance incured by pcDNA3-EGFP which is otherwise absent in untransformed cells.
                    plasmid isolation.png
                      Bands of isolated pcDNA3-EGFP plasmid as viewed under UV- transilluminator
                      PCR amplified product of miR-631.png
                        Lane 1: DNA ladder, Lane 3 , 4 and 5 :Amplified . product of miR-631 through PCR

                        DD plasmid +ligase.png
                        E coli DH5α cells transformed with Double digested vector and ligase (Negative control).
                          pcDNA+miR-631.png
                          E coli DH5 α cells transformed with constructed recombinant pcDNA3-EGFP + miR-631 plasmid (V+I).
                            +control.png
                            E coli DH5 α cells transformed with pcDNA3-EGFP plasmid (Positive control).
                              Bacterial cells were grown in ampicillin contaning LA. Presence of colonies indicate succesful transformation and cloning of plasmids. 

                              Assessment of insert (miR-631) ligation in pcDNA-3EGFP plasmid (Fig11):

                              A large number of colonies in the positive control indicated the transformation efficiency of the cells. A a good number of colonies in Test plate (V+I) indicates efficient ligation (vector and insert) and transformation. Absence of any colonies in negative control plate bearing double digested vector DNA and ligase indicate that the selected restriction enzymes (HindIII and XhoI), created uncomplimentary 3’ and 5’ sites due to which the vector plasmid could not religate and therefore the colonies obtained in the test plate are likely due to ligation of insert between complimentary overhangs produced.

                              Inser release 3.png
                              • 1
                              Gel image showing bands of double digested plasmid pcDNA3-EGFP in Lane 1 and band of double digested recombinant plasmid (pcDNA3-EGFP +miR-631) and the released insert of cloned miR-631coding DNA sequence

                              Sequencing result of the recombinant construct pcDNA3-EGFP-miR-631

                              sequencing result of miR-631.png
                                A portion of Chromatogram obtained from sequencing of recombinant pcDNA3-EGFP + miR-631 showing the inserted sequence of miR-631 (the sequence between the red lines) and the restriction sites for Hind III and XhoI restriction enzymes.

                                CONCLUSION

                                During a span of just two decades, ever since the first microRNA (miRNA) was discovered, there has been commendable expansion in the field of miRNA biology. MiRNAs have several interesting features that make them effective tool in drug development, like small, easy to synthesise, economical, and non immunogenic. Further insights into the roles of miRNAs in progression of diseases, have paved the way for creation of miRNA mimics (artificially designed RNA molecules, which mimic endogenous mature miRNAs) and antimiRs ( molecules that antagonise microRNA function), which are serving as novel therapeutic options in insuperable diseases.

                                At present, various miRNA-targeted therapeutics are under clinical drug trials, for example an antimiR of miR-122, is under phase II clinical drug trial for treatment of hepatitis ( Ottosen S and Parsley TB and Yang L and Zeh K and van Doorn LJ and van der Veer E and Raney AK and Hodges MR and Patick AK, 2015 ). Similarly, as miR-631 is relatively unexplored miRNA as compared to other miRNAs, and is expressed in almost all the major human tissues further research done in understanding the role of miR-631 in different disease conditions, can not only open new avenues for research but also pose a potential therapeutic cure in near future.

                                ACKNOWLEDGEMENTS

                                I would like to thank Prof. M. R. N Murthy, Chairman, Joint Science Education Panel, IASc for providing me the prestigious IASc-INSA-NASI Summer Research Fellowship and an opportunity to receive my training from a pre-eminent Research Institute in India, Indian Institute of Science, Bangalore.

                                I would like to extend my gratitude to Prof. Arun Kumar for accepting me as a Summer Research Fellow in his lab and for making the environment in the lab conducive enough for me to learn enough within a short period of time. I have also received the opportunity to understand the ongoing research work in AK lab through regular lab meets through which I could develop a clear perspective for pursuing a career in research.

                                I would like to thank Mr. Karthik Mallela, final year PhD student for his constant support and guidance in each and every thing that I have learnt in the lab. I would also like to thank other members of the AK lab for clarifying my doubts and for giving a friendly environment in the lab.

                                I would also like to thank Mr. C. S. Ravi Kumar, Coordinator, Science Education Programme for sincerely ensuring a comfortable and memorable stay at Indian Academy of Sciences Fellows Residency in Banglore.

                                I would like to thank my faculty from AIIMS, Jodhpur, Prof. Praveen Sharma and Dr. Purvi Purohit for their recommendation and support to be a part of this Fellowship programme. 

                                Finally, I would like to thank my family for believing in me and encouraging me to strive higher in life.

                                References

                                • Bartel DP (2004). MicroRNAs: genomics, biogenesis, mechanism, and function.. 116,

                                • Rosalind C. Lee, Rhonda L. Feinbaum, Victor Ambros, 1993, The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14, Cell, vol. 75, no. 5, pp. 843-854

                                • Pillai RS (2005). MicroRNA function: multiple mechanisms for a tiny RNA?. 11,

                                • Friedman RC and Farh KK and Burge CB and Bartel DP (2009). Most mammalian mRNAs are conserved targets of microRNAs.. 19,

                                • Ardekani AM and Naeini MM (2010). The Role of MicroRNAs in Human Diseases.. 2,

                                • Denli AM and Tops BB and Plasterk RH and Ketting RF and Hannon GJ (2004). Processing of primary microRNAs by the Microprocessor complex.. 432,

                                • Han J and Lee Y and Yeom KH and Nam JW and Heo I and Rhee JK and Sohn SY and Cho Y and Zhang BT and Kim VN (2006). Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex.. 125,

                                • O'Brien J and Hayder H and Zayed Y and Peng C (2018). Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation.. 9,

                                • Okada C and Yamashita E and Lee SJ and Shibata S and Katahira J and Nakagawa A and Yoneda Y and Tsukihara T (2009). A high-resolution structure of the pre-microRNA nuclear export machinery.. 326,

                                • Min-Sun Song, John J. Rossi, 2017, Molecular mechanisms of Dicer: endonuclease and enzymatic activity, Biochemical Journal, vol. 474, no. 10, pp. 1603-1618

                                • Yoda M and Kawamata T and Paroo Z and Ye X and Iwasaki S and Liu Q and Tomari Y (2010). ATP-dependent human RISC assembly pathways.. 17,

                                • Lin S and Gregory RI (2015). MicroRNA biogenesis pathways in cancer.. 15,

                                • Guarnieri DJ and DiLeone RJ (2008). MicroRNAs: a new class of gene regulators.. 40,

                                • Rajman M and Schratt G (2017). MicroRNAs in neural development: from master regulators to fine-tuners.. 144,

                                • Kreth S and Hübner M and Hinske LC (2018). MicroRNAs as Clinical Biomarkers and Therapeutic Tools in Perioperative Medicine.. 126,

                                • Venter M (2007). Synthetic promoters: genetic control through cis engineering.. 12,

                                • Khan S and Ullah MW and Siddique R and Nabi G and Manan S and Yousaf M and Hou H (2016). Role of Recombinant DNA Technology to Improve Life.. 2016,

                                • Cederbaum SD and Fareed GC and Lovett MA and Shapiro LJ (1984). Recombinant DNA in medicine.. 141,

                                • Cummins JM and He Y and Leary RJ and Pagliarini R and Diaz LA and Sjoblom T and Barad O and Bentwich Z and Szafranska AE and Labourier E and Raymond CK and Roberts BS and Juhl H and Kinzler KW and Vogelstein B and Velculescu VE (2006). The colorectal microRNAome.. 103,

                                • Ye Y and Wang KK and Gu J and Yang H and Lin J and Ajani JA and Wu X (2008). Genetic variations in microRNA-related genes are novel susceptibility loci for esophageal cancer risk.. 1,

                                • Lin J and Horikawa Y and Tamboli P and Clague J and Wood CG and Wu X (2010). Genetic variations in microRNA-related genes are associated with survival and recurrence in patients with renal cell carcinoma.. 31,

                                • Fabrizio Accardi, Denise Toscani, Marina Bolzoni, Benedetta Dalla Palma, Franco Aversa, Nicola Giuliani, 2015, Mechanism of Action of Bortezomib and the New Proteasome Inhibitors on Myeloma Cells and the Bone Microenvironment: Impact on Myeloma-Induced Alterations of Bone Remodeling, BioMed Research International, vol. 2015, pp. 1-13

                                • B. Barlogie, 2004, Treatment of multiple myeloma, Blood, vol. 103, no. 1, pp. 20-32

                                • Okamoto Y and Ozaki T and Miyazaki K and Aoyama M and Miyazaki M and Nakagawara A (2003). UbcH10 is the cancer-related E2 ubiquitin-conjugating enzyme.. 63,

                                • Xi H and Li L and Du J and An R and Fan R and Lu J and Wu YX and Wu SX and Hou J and Zhao LM (2017). hsa-miR-631 resensitizes bortezomib-resistant multiple myeloma cell lines by inhibiting UbcH10.. 37,

                                • Richardson SJ and Matthews C and Catherwood MA and Alexander HD and Carey BS and Farrugia J and Gardiner A and Mould S and Oscier D and Copplestone JA and Prentice AG (2006). ZAP-70 expression is associated with enhanced ability to respond to migratory and survival signals in B-cell chronic lymphocytic leukemia (B-CLL).. 107,

                                • Ottosen S and Parsley TB and Yang L and Zeh K and van Doorn LJ and van der Veer E and Raney AK and Hodges MR and Patick AK (2015). In vitro antiviral activity and preclinical and clinical resistance profile of miravirsen, a novel anti-hepatitis C virus therapeutic targeting the human factor miR-122.. 59,

                                More
                                Written, reviewed, revised, proofed and published with