Loading...

Summer Research Fellowship Programme of India's Science Academies

Construction and validation of pET28 expression vector constructs for M.smegmatis gene disA and mspde

Aditya Pal

M.Sc Microbiology, Raiganj University, Raiganj 733134, West Bengal

Prof. Dipankar Chatterji & Dr. Anirban Ghosh

Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560012

Abstract

Bacteria are well equipped to sense the changing external environment and regulate the different physiological processes accordingly. One of the reasons why Mycobacteria is such a successful human pathogen is due to its ability to adapt into host environment using different secondary messengers like c-di-GMP, c-di-AMP, (p)ppGpp, etc. Though the role of c-di-AMP has been studied in some other Gram positive pathogens like Bacillus subtilis and Staphylococcus aureus, not much is known about its physiological relevance in case of mycobacteria. Broadly, in this project we aim to do structural and functional characterization of c-di-AMP using Mycobacterium smegmatis as a model organism. We have cloned the genes for DisA Synthetase and MSPDE hydrolase, the two enzymes responsible for biosynthesis and hydrolysis of c-di-AMP to maintain cellular homeostasis and verified the constructs by DNA sequencing. These constructs will be further used for protein purification and biophysical characterization of the corresponding enzymes.  

Keywords: c-di-AMP, Mycobacteria, secondary messenger, molecular cloning, expression vector

Abbreviations

Abbreviations
c-di-AMPCyclic di Adenosine Mono Phosphate
DisADNA integrating synthase protein A 
mspdephosphodiesterase 
EtBr Ethidium bromide 
  DAC  Diadenylate cyclase 
 pApAPhosphadenylyl-adenosine 
ATPAdenosine triphosphate 
 LBLuria Bertani (Luria broth) 
 M.tb.Mycobacterium tuberculosis 

INTRODUCTION

Cyclic di-adenosine monophosphate (c-di-AMP) acts as a second messenger molecule which plays significant role in signaling pathways under some stress conditions that involves in change of pH, temperature etc. [1]. It transmits the ever changing external signals to effector molecules by binding with receptor proteins [2]. c-di-AMP was first identified in Thermotoga maritima where it was found to be involved in DNA repair mechanism [3]. After that, different studies have shown that c-di-AMP molecule is responsible for maintaining different phenotypes in different bacteria which includes maintaining the DNA integrity and regulating sporulation in Bacillus subtilis [4], maintenance of potassium ion channel homeostasis in Streptococcus pneumoniae [5], regulation of biofilm formation in Streptococcus mutans [6], regulation of cell wall synthesis and cell size in Staphylococcus aureus [7], also predicted to regulate potassium import through binding of KtrC in Mycoplasma pneumonia [8] and regulation cell wall homeostasis in Listeria monocytogens [9]. It is also seen that c-di-AMP elevates the levels of interferon β which is secreted by Listeria monocytogens infected cells [10] indicating that c-di-AMP plays important role too inducing the immune response in the host.

Mycobacterium tuberculosis (M.tb) is the causative agent of tuberculosis (TB) and considered to be one of the dangerous infectious agents in terms of mortality. According to World Health Organization (WHO) report, 10.4 million people fell sick with TB in 2016 with approximately 10% cases resulted death [11]. Due to global rise of antibiotic resistance, the situation has become even worse. Deaths reported due to MDR-TB and XDR-TB is the highest in India among all countries. M. tb directly targets host macrophages and lives in dormant state there resulting prolonged infection [12]. There have been several studies indicating role of c-di-GMP and (p)ppGpp, the other two well-studied nucleotide second messenger, for survival of the bacteria in intracellular stress conditions [13]. But the physiological implication of the structurally related nucleotide messenger c-di-AMP in M. tb is still not well understood. c-di-AMP is synthesized by diadenylcyclase (DAC) or DisA enzyme through a condensation reaction by taking 2 ATP or 2 ADP molecules. To maintain the homeostasis c-di-AMP level, another enzyme phosphodiesterase (PDE) degrades it into pApA and further to AMP. Phosphodiesterase enzyme in Mycobacterium smegmatis (M.sm) is known as MsPDE (MSMEG_2630) which contains a DHH-DHHA1 domain and shows a 200-fold higher hydrolytic efficiency (kcat/Km) to c-di-AMP than to c-di-GMP [12]. It is also found that deficiency of MsPDE significantly enhance intracellular C12-C20 fatty acid accumulation whereas deficiency of DAC enzyme in many bacteria results in cell death [12].

1_19.png
    Synthesis and degradation of c-di-AMP

    Scope of the Study

    There has been no particular study which describes the biological role of the newly discovered second messenger c-di-Amp in M.tb. In this particular project we aim to do protein purification and biochemical characterization of DisA (Sythetase) and MsPDE (hydrolase) enzymes which are responsible for cellular homeostasis of c-di-AMP in M.semgmatis which is considered to be an excellent model organism for tuberculosis research.

    During my short tenure, I focused on construction of expression vector constructs for disA and mspde gene by restriction digestion based cloning method and confirmation of the same by DNA sequencing.

    LITERATURE REVIEW

    METHODOLOGY

    Primary Culture Preparation of M.smegmatis MC2 155

    Media used

    Sterile MB7H9 broth containing 2% glucose and 0.05% Tween 80

    • Sterile MB7H9 broth containing 2% glucose and 0.05% Tween 80
    •  Colonies of wild type M.smegmatis MC2 155

    Procedure

    • The MB7H9 media is autoclaved for sterilzation .
    • Glucose (2%) and Tween 80 are mixed in the media.
    • One colony of M.smegmatis MC2 155 is taken for inoculating the media.
    • The culture media is placed in incubator for overnight incubation at 37°C.

    Isolation of Genomic DNA from M. smegmatis MC2 155 

    Material required

    •  Primary culture of M. smegmatis MC2 155 strain
    •  Centrifuge
    • Lysozyme (10mg/ml)
    • 10% SDS
    • Proteinase K (2mg/ml)
    • 5M NaCl
    • Chloroform –Isoamyl alcohol (24:1)
    • 70% ethanol
    • Elution buffer

    Procedure

    • 10ml of overnight grown wildtype (WT) culture of M. smegmatis MC2 155 was taken in falcon tubes and Centrifuged @ 5000 rpm for 10min.
    • 450ul P1 resuspension buffer is added into the pellet, which has RNase activity.
    • 50 ul of lysozyme (10mg/ml) added.
    • The suspension is then incubated overnight at 37°C, then 100ul of 10% SDS was added followed by 50ul proteinase K and kept in 55°C dry bath for 30 min.
    • 200 ul 5M NaCl was added followed by 1ml chloroform-isoamyl alcohol mixture.
    • Tubes centrifuged at 13000 rpm for 10 minutes at room temperature (RT).
    • The aqueous layer was then transferred to another tube.
    • Isopropanol was added 0.7 of total volume.
    • Tubes are centrifuged at 13,000 rpm at RT for 10 minutes.
    • Pellet was washed with 1ml of 70% ethanol and then centrifuged at 10,000 rpm for 10 minutes.
    • The pellet was air-dried in hot air oven for 30 mins for the residual ethanol to evaporate.
    • 50ul elution buffer (from Qiagen kit) is added into pellet and the DNA was resuspended.
    • Then the tubes were incubated at 55°C for 10min, concentration checked and kept in 4°C for future use.

    Checking Genomic DNA Concentration

    Nanodrop spectrophotometer was used for determining the concentration of genomic DNA and milliQ water used as blank.

    Genomic DNA Analysis by Agarose Gel Electrophoresis

    Materials used

    •      Agarose
    •      1X TAE Buffer
    •      Gel casting tray
    •      Ethidium bromide (EtBr)
    •      Gel Comb
    •      1kb DNA ladder
    •      6X gel loading buffer.

    Procedure

    • 1 gm agarose powder was added in 100ml 1X TAE buffer and heated until agarose got dissolved completely.
    • After it reached hand bearable temperature, EtBr was added (2 ug/ml.) and mixed well.
    • It was then poured into gel casting tray and a comb (8 well) was placed.
    • After the gel got solidified, the comb is removed and the mold was placed in an electrophoretic chamber fully submerged in 1X TAE buffer.
    • The samples were loaded carefully into the well after mixing with 6X DNA loading dye.
    • 1kb DNA ladder was used as a marker.
    • The gel was run at −80V for 1–2 hours.
    • The bands were observed under UV transilluminator.

    Image Documentation of Agarose Gel Electrophoresis

    Agarose gel was visualized and documented in gel documentation system using GelSys Software under UV light (Lighting by TLUM Mid wave; 200ms exposure).

    Identification of the Sequence of Gene of Interest

    Sequence of disA and pde gene were identified from Mycobrowser website. The gene accession number MSMEG_6080 and MSMEG_2630 were obtained from the whole genome of wild type M. smegmatis MC2 155 chromosome in FASTA format.

    Primer Designing

    Both Forward and Reverse primers were designed by taking the disA gene and mspde gene as the template. Proper restriction sites were added to it. For disA primers Nco1, Not1 restriction sites are added where Nco1 is added in forward primer and Not1 is added in reverse primer, and in case of pde primers Nco1, Xho1 restriction sites are added where Nco1 was added in the forward primer and Xho1 site was added in the reverse primer. pET28a (KanR) vector was selected for cloning which has inframe C-terminal His Tag after the cloning site.

    Forward primer is designed by taking eighteen bases sequence of the 5’ end of the gene of interest and reverse primer by taking the reverse complement of the 3’ end of the gene of interest. Restriction sites were added just before the bases. An additional few bases were also added to the 5’ end of the primer sequence. 

    Melting temperature was determined using this formula, Tm = [2(A+T) + 4(G+C)] and also checked in Tm calculator toll in New England Biolabs website.

    Isolation of Plasmid DNA (pET28a) 

    Materials required

    • Overnight grown culture (grown in LB+ 50ug/ml. Kanamycin final concentration) of E.coli DH5α with pET28a.
    • Centrifuge and eppendorf tubes
    • Favorprep Plasmid Extraction Mini Kit using different buffers: FAPD1 Buffer (RNase A added), FAPD2 Buffer, FAPD3 Buffer, W1 Buffer, Wash Buffer (96–100% ethanol added), Elution Buffer and FAPD column with collection tube.

    Procedure

    • Colonies from LB agar plates containing kanamycin (50ug/ml) were inoculated in 5ml LB tubes containing same concentration of Kanamycin.
    • Tubes were kept in incubator shaker overnight at 150 rpm at 37°C.
    • 4 ml of culture is transferred into 4 eppendorfs (each containing 1 ml).
    • It was centrifuged at 6000 rpm for 5 minute to pellet down the cells.
    • The supernatant was discarded and 200µl of FAPD1 Buffer was added to the pellet.
    • Then cells were resuspended completely by pipetting.
    • 200µl of FAPD2 Buffer was added. The tube was then gently inverted for 5 times.
    • It was then incubated at room temperature for 1 minute.
    • 300µl of FAPD3 Buffer was added and the tube was immediately inverted 5 times to neutralize the lysis buffer.
    • Centrifugation was done at 13000 rpm for 5 minutes and the supernatant was carefully transferred to the FAPD Column.
    • It was then centrifuged at 13000 rpm for 30 seconds and the flow-through was discarded.
    • The column was then placed back in the collection tube and 400µl of W1 Buffer was added to the column.
    • Centrifugation was done at 13000 rpm for 30 seconds and flow-through was discarded.
    • 700µl of Wash Buffer was added to the column and centrifuged at 13000 rpm for 30 seconds.
    • Flow-through was discarded and the sample was centrifuged at 13000 rpm for additional 2 minutes to remove residual ethanol.
    • Column was placed in a new 1.5 ml eppendorf tube.
    • 50µl of Elution Buffer was added to the center of the membrane and allowed to stand for 2 minutes.
    • It was centrifuged at 13000 rpm for 1 minute to elute the plasmid DNA.
    • Plasmid was stored at −20°C.
    • Plasmid was quantified using nanodrop spectrophotometer (took Elution Buffer as blank).
    • Plasmid was analyzed through 1% agarose gel. Bands were visualized and documented by gel documentation system.

    Polymerase Chain Reaction 

    Ploymerase chain recation (PCR) is used to amplify a gene sequence using a genomic DNA which has the sequence of interest. DNA polymerase helps in synthesizing new strands of DNA using dNTPs and two sets of primers. Mg2+ required by the polymerase enzyme is supplemented by Phusion buffer.

    Materials required

    • Genomic DNA
    • Forward primer
    • Reverse primer
    • dNTP
    • Sterile milliQ water
    • Phusion polymerase
    • 5X Phusion GC reaction buffer
    • PCR tubes and PCR machine 

    Procedure 

    Reaction mixture for volume of 50µl master mix.

    PCR Reaction master mix
    Components Final concentration Volume(µl)
    5X Phusion Buffer HF 1X 10
    10mM dNTP 200 µM 1.2
    10µM Forward primer 0.5 µM 2.5
    10µM Reverse primer 0.5 µM 2.5
    Template DNA(Genomic DNA) 100 ng 0.5
    Phusion DNA Polymerase 1 unit 0.5
    Sterile milliQ water - 32

    Reaction conditions

    ·         Initial Denaturation : 98°C for 2 min

    ·         Denaturation : 98°C for 30 sec

    ·         Annealing : 45–72°C for 30 sec

    ·         Extension : 72°C for 1 min

    ·         Final extension : 72°C for 10 min

    ·         Hold : 4°C

    PCR was done for 35 cycles.

    PCR Product Purification

    Materials used 

    •  QIA quick PCR Purification Kit
    •  Buffer PB
    •  Column and collection tube
    •  Buffer PE (ethanol added; 96%)
    •  Elution buffer

    Procedure

    • 5 times volume of Buffer PB was added to 1 volume of the PCR sample and mixed properly.
    • QIAquick spin column was placed in a 2 ml collection tube and the sample was added to the column.
    • Centrifugation was done at 13000 rpm and room temperature for 1 minute.
    • Flow-through was discarded and 0.75ml of Buffer PE was added to wash the column.
    • It was then centrifuged at 13000 rpm and room temperature for 1 min.
    • The flow-through was discarded and centrifuged for an additional 1 minute.
    • Column was placed in a fresh 1.5ml eppendorf tube.
    • 30µl of Buffer EB was added to the center of the column and allowed to stand for 1–2 minute.
    • It was then centrifuged at 13000 rpm and room temperature for 1 minute.
    • Purified sample was stored at −20°C.
    • Concentration was determined using nanodrop spectrophotometer with Buffer EB as blank.

    Restriction Digestion (Double Digestion)

    Materials used

    Digestion for disA cloning:
    Reaction mixture components pET28a(µl) disA insert(µl)
    DNA 30 15
    Cut smart Buffer(µl) (1X) 5 3
    NcoI-HF 1U 1
    NotI-HF 1U 1
    Sterile H2O(µl) 13 10
    Final volume(µl) 50 30
    Digestion for mspde cloning
    Reaction mixture pET28a (µl) mspde(µl)
    DNA(µl) 30 15
    Cut smart Buffer(µl) (1X) 5 3
    NcoI-HF 1U 1
    XhoI-HF 1U 1
    Sterile H2O(µl) 13 10
    Final volume(µl) 50 30

    1 nondigested vector control was also Set up to compare the restriction digestion in gel

    Procedure

    • After preparation of the master mix according to the above mentioned table in an eppendorf tube, it was incubated at 37°C waterbath for 30 mins.
    • After that heat inactivation of the double digested insert DNA was done by putting in 80°C of water bath for 20 minutes.

    Gel Extraction of the Digested Vector Backbone

    Restriction digested vector samples were run on 1% agarose gel and visualized under UV transilluminator for bands and cut the desired band with sterile blade and collected in an eppendorf tube.

    Materials needed

    •          QIAquick gel extraction kit: Buffer QG, Buffer PE (ethanol 96–100% added), Buffer EB
    •          Sterile scalpel
    •          UV transilluminator
    •          Weighing balance
    •          Centrifuge and eppendorf tubes
    •          Hot water bath
    •          Vortex
    •          Isopropanol

    Procedure

    1. The cut gel part is weighed and 3 times of QG buffer added into it and put it at 50 deg C for 10 minutes until the gel is completely dissolved.

    2. After that 1 Volume of isopropanol was added and mixed.

    3. The solution was transferred to Qiagen column tubes and centrifuged at 13000 rpm for 1 minute.

    4. After discarding the flow through 750ul of wash buffer PE was added into the column and centrifuged at 13000 rpm for 1 minute. The column was centrifuged for additional 1 minute

    5. Column was placed into a sterile ependorf tube and 30 ul of elusion buffer was added at the center of the column and left it to stand for 1 minute and finally, the centrifugation was done at 13000 rpm for 1 minute.

    Concentration check of double digested products

    Concentration of gel extracted double digestion product was measured using nanodrop spectrophotometer with Buffer EB as blank.

    Dephosphorylation of Vector

    To prevent vector recirculization dephosphorylation is needed.

    Reaction master mix
    Reaction mixture componentsvolume(µl)
    DNA   16 
    rSAP(Shrimp alkaline phosphatase)  5 
    Cutsmart buffer (10X)  1
    H20  1
    Total volume   20 

    Procedure

    • Mixture is incubated at 37°C for 30 minutes.  
    • Inactivation done at 65°C for 5 minutes.

    Phosphorylation of Insert

    Reaction master mix
    Reaction mixture componentsvolume(µl)
    DNA 12 
    ATP(10mM)  5 
     T4 PNK(phosphokinase)  1
    H20  32
    Total volume 50 

    The mixtures is incubated at 37°C & inactivation was done by keeping in 65°C for 20 minutes.

    Ligation Reaction

    Vector to insert ratio of 1:3 was used (volume calculated according to concentration) for cohesive end ligation.

    Materials required

    Ligation reaction mixture
    Reaction mixture  components Volume(µl)
    10X T4 DNA Ligase Buffer 2
    Vector DNA 10
    Insert DNA 4
    T4 DNA Ligase 1
    Sterile H2O 3
    Total volume 20µl

    Procedure

    • Ligation was done at 16°C for overnight. One mock ligation mixture was set up without insert to address the false background transformants.
    • After that heat inactivation was done by kept in 65°C for 10 minutes.

    Preparation of Competent DH5α Cells

    Competent cells are those which can incorporate plasmid and foreign DNA upon transformation. 

    Materials required

    • Overnight grown culture (grown in LB) of E.coli DH5α
    • Centrifuge
    • Ice
    • CaCL2(0.1M)
    • Glycerol (15%)
    • Eppendorf tubes
    • Liquid Nitrogen

    Procedure

    • A single colony of DH5α is inoculated into 5ml LB in 50ml sterile falcon tube & grown at 37°C at 150 rpm overnight.
    • 1ml is inoculated to 100 ml LB in 250 ml flask in the next day.
    • Flask was Incubated it at 37°C in shaking incubator for till OD600 reaches 0.6.
    • Then the cells were kept on ice for 20 min.
    • The cell pellet was collected after centrifugation for 10 min @ 6000 rpm at 4°C.
    • Supernatant was removed and the pellet was gently resuspended in 20 ml of 100mM CaCl2.
    • The centrifugation was done in 3500 rpm for 30 min.
    • Steps 6 and 7 were repeated one more time.
    • Finally, the supernatant was discarded & gently resuspended on 4ml cold 0.1M Cacl2 containing 15% Glycerol and pellet was dissolved uniformly.
    • The resuspended culture was then aliquoted in microtubes (100ul/tube) and quick freeze was done using liquid N2 and then stored in −80°C for future use.
    • Transformation efficiency was checked by transforming pET28 blank vector.

    Transformation

    Now the individual ligation mix are added into 50ul of competent cells of DH5α and transformation is performed by heat shock method.

    Materials required  

    • Competent cells of DH5α
    • Ice and hot water bath
    • Plasmid
    • Sterile warm LB media
    • Centrifuge and eppendorf tubes
    • LB agar plates containing antibiotics (Kanamycin and ampicillin)

    Procedure

    • Competent cells of DH5α were taken and stored in ice for complete thawing.
    • Plasmids and ligation mix are added into competent cells and kept in ice for 30 minutes.
    • Heat shock was given by incubating in water bath for 1 minute at 42°C.
    • It was then immediately taransferred in ice and kept for 10 mins.
    • 1ml of sterile warm LB broth was added into it.
    • The tubes were then incubated in shaker at 150 rpm and 37°C for 1 hour.
    • After incubation 100ul taken from it and spread in kanamycin containing LB agar plate.
    • Remaining 900ul was centrifuged and after discarding the supernatant the pellet was resuspended in 100µl LB media and spread in LB-kanamycin plates.
    • The plates were incubated at 37°C overnight.
    • Primary screening for the right clones was done by Colony PCR followed by restriction digestion based insert release.

    RESULTS AND DISCUSSION

    Isolation of Genomic DNA

    Concentration of isolated genomic DNA from M.smegmatis MC2 155 strain by nanodrop was 920ng/ul. It was also analyzed by running in 1% agarose gel.

    1_3.png
      Genomic DNA of M.smegmatis mc2 155 in 1% agarose gel; Lane 1 - 1kb DNA ladder , Lane 2 - Genomic DNA.

      Primer Designing

      Forward and reverse primers were designed for pde, disA. Tm value of these two primers are 72ºC.

      Primer sequences used

      disA forward:5’ATATGAATTCTAATGGCCGTGAAGTCCGGCGCGA 3’(Tm-73 ºC,GC content 50%)

      disA reverse: 5’ATATTCTAGATCAGGCCAGCCGGTCGGCGATCGT 3’(Tm-75 ºC,GC content 56%)

      mspde forward:5’CATGCCATGGGGCCGGTGACGACAACCGATC 3’(Tm-77 ºC,GC content - 65%)

      mspde reverse:5’CCGCTCGAGGCCAAGGGCCCGTGCGAG 3’ (Tm-79 ºC,GC content - 78%)

      pET28a Plasmid

      pet 28 his.png
        pET28a plasmid map
        1_2.png
          pET28a plasmid DNA run in 1% agarose gel after restriction digestion

          Gel Extraction of Plasmid DNA

          After the restriction digestion, plasmid samples were loaded with 6x loading dye in 1% agarose gel.

          1_4.png
            Agarose gel run of pET28 cut with restriction enzymes; Lane 1 - 1kb DNA ladder, Lane 2-Non digested control, Lane 4-pET28a(Nco1,Not1 cut), Lane 6 - pET28a(Nco1,Xho1 cut) 

            Polymerase Chain Reaction

            To detect the exact annealing temperature for disA and pde gene primers, gradient PCR was done. After that we scaled up that product by running at the best specific temperature. For disA PCR was run on 68ºC and for mspde 2 step PCR was done at 72ºC. PCR amplified disA and pde gene were run on a 1% agarose gel to analyze the bands. Band came around 1 kb position because size of disA is 1119bp and mspde is of 1023bp.

            1_5.png
              PCR amplified products (a.)disA and (b.) mspde on 1% agarose gel;Lane 1-1kb gene ruler,Lane 2- PCR amplified product,Lane 3 –Non template control 

              Transformation

              Ligated products i.e. pET28a-disA & pET28a-mspde, were transformed into competent DH5α cells and plated into LB agar plates containing Kanamycin. Colonies were observed after overnight incubation.

              1_7.png
                Transformation plates after ligation for disA with(left) and without insert(right).
                1_8.png
                  cloning transformation plates of mspde with(left) and without insert(right)

                  Screening of colonies by colony PCR

                  PCR mastermix is prepared by taking forward and reverse primer annealing at vector sequence upstream and downstream of cloning sites respectively. After colony PCR screening of positive clones were found for both.

                  1_10.png
                    Colony PCR result of (a) pET28a-disA and (b) pET28a-pde transformants. The higher band in both the gels indicating the positive clone.

                    Clone confirmation by restriction digestion based insert release

                    1_12.png
                      pET28a disA clone insert release
                      1_13.png
                        pET28a mspde clone insert release

                        Sequence Analysis

                        The clones were preserved at −80°C and extracted plasmids were send for sequencing. After analysing we found sequences of the clones clean, without any mutation and C-terminal his-tag was also in-frame with both disA and mspde genes.

                        1_14.png
                          : (a)pET28-disA clone sequence analysis by pairwise alighnment and (b)disA insert sequencing data
                          1_15.png
                            Confirmation of6X Histidine coding sequence at C terminal end of disA
                            1_16.png
                              :(a)pET28-pde clone sequence analysis by pairwise alighnmentand(b)pde insert sequencing data
                              1_18.png
                                Confirmation of 6X Histidine coding sequence at C terminal end of mspde

                                CONCLUSION

                                In this short project, I learnt how to make vector constructs by restriction digestion based cloning technique. The two genes in the final construct I fused (in-frame) with 6X-His Tag (C-terminal) which will be further used for protein purification and characterization studies.

                                REFERENCES

                                [1] Hengge, R.; Grundling, A.; Jenal, U.; Ryan, R.; Yildiz, F. Bacterial signal transduction by cyclic di-GMP and other nucleotide second messengers. J. Bacteriol. 2016, 198, 15-26.https://www.ncbi.nlm.nih.gov/pubmed/26055111​

                                [2] Kalia, D.; Merey, G.; Nakayama, S.; Zheng, Y.; Zhou, J.; Luo, Y.L.; Guo, M.; Roembke, B.T.; Sintim, H.ONucleotide, c-di-GMP, c-di-AMP, cGMP, cAMP, (p)ppGpp signaling in bacteria and implications inpathogenesis. Chem. Soc. Rev. 2013, 42, 305–341.https://www.ncbi.nlm.nih.gov/pubmed/23023210

                                [3] Witte, G.; Hartung, S.; Buttner, K.; Hopfner, K.P. Structural biochemistry of a bacterial checkpoint proteinreveals diadenylate cyclase activity regulated by DNA recombination intermediates. Mol. Cell 2008, 30,167–178.https://www.ncbi.nlm.nih.gov/pubmed/18439896

                                [4] Oppenheimer-Shaanan, Y.; Wexselblatt, E.; Katzhendler, J.; Yavin, E.; Ben-Yehuda, S. c-di-AMP reports DNA integrity during sporulation in Bacillus subtilis. Embo Rep. 2011, 12, 594–601.https://www.ncbi.nlm.nih.gov/pubmed/21566650

                                [5] Bai, Y.L.; Yang, J.; Zarrella, T.M.; Zhang, Y.; Metzger, D.W.; Bai, G.C. Cyclic di-AMP impairs potassium uptake mediated by a cyclic di-AMP binding protein in Streptococcus pneumoniae. J. Bacteriol. 2014, 196,614–623.https://jb.asm.org/content/196/3/614

                                 [6] Cheng, X.Q.; Zheng, X.; Zhou, X.D.; Zeng, J.M.; Ren, Z.; Xu, X.; Cheng, L.; Li, M.Y.; Li, J.Y.; Li, Y.Q. Regulation of oxidative response and extracellular polysaccharide synthesis by a diadenylate cyclase in Streptococcus mutans. Environ. Microbiol. 2016, 18, 904–922.https://www.ncbi.nlm.nih.gov/pubmed/26548332

                                 [7] Corrigan, R.M.; Campeotto, I.; Jeganathan, T.; Roelofs, K.G.; Lee, V.T.; Grundling, A. Systematic identification of conserved bacterial c-di-AMP receptor proteins. Proc. Natl. Acad. Sci. USA 2013, 110, 9084–9089.https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3670340/

                                 [8] Blötz, C.; Treffon, K.; Kaever, V.; Schwede, F.; Hammer, E.; Stülke, J. Identification of the components involved in cyclic di-AMP signaling in Mycoplasma pneumoniae. Front. Microbiol. 2017, 8, 1328. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5508000/

                                 [9] Witte, C.E.; Whiteley, A.T.; Burke, T.P.; Sauer, J.D.; Portnoy, D.A.; Woodward, J.J. Cyclic di-AMP is critical for Listeria monocytogenes growth, cell wall homeostasis, and establishment of infection. Mbio 2013, 4, e00282-13.https://mbio.asm.org/content/4/3/e00282-13

                                [10] Woodward, J.J.; Iavarone, A.T.; Portnoy, D.A. c-di-AMP secreted by intracellular Listeria monocytogenes activates a host type I interferon response. Science 2010, 328, 1703–1705. https://www.ncbi.nlm.nih.gov/pubmed/20508090

                                [11] https://www.who.int/gho/tb/epidemic/cases_deaths/en/

                                [12] Functional Analysis of a c-di-AMP-specific Phosphodiesterase MsPDE from Mycobacteriumsmegmatis by Qing Tang, YunchaoLuo, Cao Zheng, Kang Yin, Maria Kanwal Ali, Xinfeng Li, Jin HeInternational Journal of Biological Sciences 2015; 11(7): 813-824. doi: 10.7150/ijbs.11797.http://www.ijbs.com/v11p0813.htm

                                [13] Novel Functions of (p)ppGpp and Cyclic di-GMP in Mycobacterial Physiology Revealed by Phenotype Microarray Analysis of Wild-Type and Isogenic Strains of Mycobacterium smegmatisGupta KR, Kasetty S, Chatterji D.https://www.ncbi.nlm.nih.gov/pubmed/25636840

                                ACKNOWLEDGEMENTS

                                I would like to express my sincere gratitude to Prof. Dipankar Chatterji, Molecular Biophysics Unit, Indian Institute of Science (IISc) for allowing me to work in his lab and for providing me an excellent platform for development. I thank him for his valuable guidance and giving me an opportunity to involve with a great research project.

                                I also wants to thank IASc-INSA-NASI for giving me this kind opportunity to selecting me in this summer research fellowship programme.

                                I am extremely grateful to my mentor Dr. Anirban Ghosh for taking me in his project and always being supportive and thanks for pointing out my mistakes. He has always shown great patience during this project work. I am thankful for that.

                                I am also thankful to all my seniors in the lab Avisek Mahapa, Anushya Petchiappan, Unnati Patel, Sudhanshu Gautam, Sujay Naik, Pranami Goswami, Anil Kumar, Shah Nisha and Sunita Prakash for their valuable suggestions and help during the whole span of my work. They were very friendly and I am thankful for all the lab treat, food and the wonderful moments I had with them. It has been my privilege to work with these extremely talented peoples.

                                I would also like to thank my fellow trainees Siddhartha Chakraborty and Srishti Mittal for being helpful and supportive throughout my project. I also thank my friends and roommates of jallahali guest house who gave me wonderful company during this time in Bangalore.

                                More
                                Written, reviewed, revised, proofed and published with