Loading...

Summer Research Fellowship Programme of India's Science Academies

Cloning of disA gene from Mycobacterium smegmatis

Anjali J B

Central University of Tamil Nadu, Tiruvarur 610101

Guided by:

Dipankar Chatterji

Honorary Professor, Molecular Biology Unit, Indian Institute of Science, Bangalore 560012

Abstract

Cyclic di-AMP is one of the recently discovered secondary messengers in bacteria. Since its discovery in 2008, the inevitable role of c–di-AMP has been identified in various bacterial species. It regulates different bacterial physiological processes including host-pathogen interactions. It plays a significant role in the regulation of normal growth and fatty acid metabolism in Mycobacterium smegmatis. It also helps Staphylococcus aureus to grow in low-potassium concentration and also maintains DNA integrity in Bacillus subtilis. Cyclic di-AMP is involved in establishing bacterial infections by coordinating host-pathogen interaction. Alteration in the level of c-di-AMP was found to be detrimental for many bacteria. Cyclic-di-AMP is produced from two ATP molecules by diadenylate cyclase (DAC) enzyme and is degraded to 5ˈ-phosphadenylyl-adenosine (pApA) by phosphodiesterase (PDE) enzyme. Recently, DNA integrity scanning protein (DisA) has been identified in M. smegmatis, having diadenylate cyclase activity. This protein has shown the ability to synthesize c-di-AMP from ATP. Currently, less information is available about the regulatory pathways of this protein. In order to study the functions of this protein, we intend to clone and purify DisA protein from M. smegmatis MC2 155. In this project, disA gene from M. smegmatis MC2 155 was amplified by using appropriate primers. The amplified fragment was digested and ligated into pET21b vector. The vector was then transformed into competent E coli DH5α cells. Plasmid (pET21b-disA) will be isolated and digested to check proper insert size, followed by sequencing and purification of DisA protein.

Keywords: cyclic-di-AMP, secondary messenger, primers, vector, transformation, competent cell

Abbreviations

DAC - Diadenylate cyclase

pApA - Phosphadenylyl-adenosine

PDE - Phosphodiesterase

DisA - DNA integrity scanning

ATP - Adenosine triphosphate

WHO - World Health Organization

TB - Tuberculosis

PCR - Polymerase chain reaction

MB7H9 - Middlebrook7H9

OD - Optical density

SDS - Sodium Dodecyl Sulphate

NaCl - Sodium chloride

WT - Wild Type

DNA - Deoxyribonucleic acid

ng - nanogram

µl - microlitre

LB - Luria Bertani (lysogeny broth/lennox broth)

mg - milligram

ml - milliliter

rpm - revolutions per minute

NaOH - Sodium hydroxide

µM - micromolar

CaCl2 - Calcium chloride

TAE - Tris acetate EDTA

MnCl2 - Manganese chloride

EtBr - Ethidium bromide

dNTP - deoxyribonucleotide triphosphate

HF - High Fidelity

MOPS - 3-(N-morpholino) propanesulfonic acid

nm - nanometer

UV - ultraviolet

FASTA - Fast Adaptive Shrinkage Thresholding Algorithm

NCBI - National Centre for Biotechnology Information

bp - basepair

A - Adenine

T - Thymine

G - Guanine

C - Cytosine

Tm - Melting temperature

mg - milligram

RbCl2 - Rubidium chloride kDa - kilodalton

IPTG - Isopropyl β-D-1-thiogalactopyranoside

Ni-NTA - Nickel-nitrilotriacetic acid

Introduction

Mycobacterium smegmatis are gram positive bacteria mostly residing on soil and water. Their growth is comparatively slower than other bacteria with a generation time of 3.5 hours. Their cell wall consists of mycolic acid. These hydrophobic cell wall makes them resistant to antibiotics. Mycobacterium tuberculosis is the prime source of tuberculosis in humans [​Hett and Rubin 2008​]. According to WHO, tuberculosis is one of the top ten causes of death worldwide. It is extremely depressing to know that India accounts for 64% of new TB cases every year.

Signaling nucleotides are present in all forms of life. Cyclic-di-AMP is one of the recently discovered secondary messengers in the list which is predominant in gram positive bacteria. It was seen associated with the crystal structure of DisA protein [​Romling et al 2013​] [​Devaux et al 2018​]. Knowing more about the biology of c-di-AMP can open up new paths for research. Production of c-di-AMP is increased during stationary phase in S. aureus [​Corrigan et al 2015​]. As a result it might have a great role in bacterial survival. It helps many bacteria to survive in various stressful conditions. Cyclic-di-AMP also ensures that DNA integrity is maintained at the time of sress [​Corrigan and Gründling 2013​]. It plays a major role in cell wall synthesis and sporulation in Bacillus subtilis [​Romling et al 2013​]. Cyclic-di-AMP synthesized by M. tuberculosis binds to macrophages and result in host-pathogen interactions [​Romling et al 2013​]. It also helps in transport and cell wall metabolism in addition to virulence and stress resistance which are critical for bacterial growth. Resistance to β-lactam drugs were seen reduced when c-di-AMP levels were decreased [​Romling et al 2013​]. Cyclic-di-AMP binds to a receptor or target proteins and control specifc cellular pathways [​Corrigan and Gründling 2013​]. It was observed that c-di-AMP controls cell division in S. aureus [​Corrigan et al 2011​]. Despite its importance, the role of this secondary messenger in M. smegmatis is not studied widely. Very little information is available about the signaling pathway mediated by c-di-AMP and the alteration in its level due to various external conditions.

Cyclic-di-AMP is produced from two ATP molecules by diadenylate cyclase (DAC) enzyme and is degraded to 5ˈ-phosphadenylyl-adenosine (pApA) by phosphodiesterase (PDE) enzyme ​Fig 1​.

Picture1_1.jpg
    Synthesis and hydrolysis of c-di-AMP

    Objectives

    This study was carried out as a short term objective to clone c-di-AMP synthesizing gene (disA) and to purify DisA protein for use in further studies.

    Screenshot (214)_1.png
      Plasmid map of pET21b with restriction sites

      Materials and methods

      Preparation of primary culture of wild type M. smegmatis MC2 155 strain

      Materials required

      • Sterile MB7H9 broth containing 2% Glucose and 0.05% Tween 80
      • Colonies of wild type M. smegmatis MC2 155 strain

      Procedure

      • Colonies from MB agar plates containing 2% glucose were inoculated in 10 ml MB7H9 tubes.
      • Tubes were kept in incubator shaker overnight at 150 rpm and 37°C under aseptic conditions.

      Note

      • Glucose act as the carbohydrate source and Tween 80 prevents aggregation of cells.

      Isolation of genomic DNA from M. smegmatis MC2 155

      Materials required

      • Primary culture of wild type M. smegmatis MC2 155 strain
      • Centrifuge and eppendorf tube
      • Dry bath
      • P1 (RNase added) Resuspension Buffer from Qiagen Plasmid Miniprep Kit
      • Lysozyme (10mg/ml) - from chicken egg white powder
      • 10% SDS
      • Proteinase K (2mg/ml)
      • 5M NaCl
      • Chloroform-Isoamyl alcohol (24:1)
      • Isopropanol
      • 70% ethanol wash from 100% pure
      • Elution buffer from Qiagen Kit/milliQ water

      Procedure

      1. Bacterial cells were harvested (at 5,000 rpm and 25°C for 10 min) from 8 ml culture and collected in 1.5 ml eppendorf tube.

      2. The supernatant was discarded and the harvested cells were resuspended by adding 450µl of P1 resuspension buffer.

      3. 50µl lysozyme was added to it and incubated overnight at 37°C.

      4. After overnight incubation 100µl of 10% SDS and 50µl of proteinase K were added.

      5. It was then kept in 55°C dry bath for 30 minutes.

      6. 200µl of 5M NaCl was added to the sample.

      7. 1 ml from Chloroform-Isoamyl alcohol mixture (24:1) was added and mixed by inverting the tube few times.

      8. It was then centrifuged at 13,000 rpm for 10 minutes at room temperature.

      9. Upper aqueous layer was transferred to another eppendorf tube.

      10. Isopropanol was added as 70% of total volume and the tube was inverted few times to see a white thread like precipitate of DNA.

      11. It was then centrifuged at 13,000 rpm and room temperature for 10 minutes.

      12. The supernatant was discarded and the pellets were washed with 1ml of 70% ethanol.

      13. It was then centrifuged at 10,000 rpm at room temperature for 10 minutes.

      14. The pellet was air dried until ethanol was completely removed.

      15. 100µl filter sterilized milliQ water was added to elute the sample.

      16. Sample was then stored at 4°C.

      Note

      • Vortex should not be done after lysozyme addition.
      • The pellet should not be dislodged after ethanol wash.
      • It is preferable to heat the milliQ water at 55°C in dry bath before elution.
      • The eluent should not be stored at -20°C to prevent shearing of DNA.

      Determination of concentration of purified genomic DNA

      Nanodrop spectrophotometer and nanodrop thermofisher software was used for determining the concentration of genomic DNA with milliQ water as blank. The concentration was measured in ng/µl.

      Analysis of genomic DNA by Agarose gel electrophoresis

      Materials required

      • Agarose
      • 1X TAE Buffer (40mM Tris pH-7.6, 20mM Acetic Acid, 1mM EDTA)
      • Gel casting tray
      • Comb
      • Electrophoretic chamber
      • Ethidium bromide (5mg/ml)
      • 1kb DNA ladder (Thermo scientific generuler)
      • 5X nucleic acid sample loading buffer

      Procedure

      • 0.8g Agarose powder was added in 100ml 1X TAE Buffer (0.8% gel) and heated for 5 minutes to get a clear solution.
      • It was allowed to reach hand bearable temperature.
      • 8µl of EtBr was added and mixed well.
      • It was then poured into gel casting tray and an 8 well comb was placed immediately.
      • It was then allowed to set.
      • After solidification of the gel, mold was placed in an electrophoretic chamber along with the gel casting tray and was immersed completely in 1X TAE Buffer.
      • The comb was removed and the samples were loaded carefully into the well along with 1X dye
      • 1kb DNA ladder was used as a marker.
      • The gel was run at ~80V for 1-2 hours.
      • The bands were observed under UV transilluminator.

      Gel Documentation of Agarose gel electrophoresis

      Agarose gel was visualized and documented in gel documentation system using GelSys Software under UV light (Lighting-TLUM Mid wave; 400ms exposure)

      Identification of the sequence of gene of interest

      Sequence of disA gene was identified from NCBI website. The gene accession number MSMEG_6080 was obtained from the whole genome of wild type M. smegmatis MC2 155 chromosome in FASTA format.

      Primer Designing

      Both Forward and Reverse primers were designed by taking the disA gene (MSMEG_6080) as the template. Primers were 24 base pair long. Proper restriction sites were added to it. In the case of forward primer EcoRI and for reverse primer HindIII restriction sites were added. pET21b vector was selected for cloning.

      Twelve bases each were taken from the complementary sequence of the 5’ end of the gene of interest and reverse complement of the 3’ end of the gene of interest. Restriction sites were added just before the bases. An additional six bases were also added to the 5’ end of the primer sequence.

      Melting temperature was calculated as, Tm = [2(A+T) + 4(G+C)].

      Note

      • Primer length should be 18-22 bp.
      • Tm should be between 52-58°C.
      • GC content should be 40-60% of total bases.
      • It is preferable to use restriction enzymes with six nucleotide sequence, sticky ends and specificity.

      Primary culture of E. coli DH5α

      Materials required

      • Sterile LB broth containing ampicillin (100mg/ml) for pET21b
      • Colonies of pET21b transformed in E. coli DH5α

      Procedure

      • Colonies from LB agar plates containing ampicillin were inoculated in 10 ml LB tubes for pET21b.
      • Tubes were kept in incubator shaker overnight at 150 rpm and 37°C under aseptic conditions.

      Isolation of plasmid DNA (pET21b)

      Materials required

      • Primary culture of pET21b transformed in E. coli DH5α
      • Centrifuge and eppendorf tubes
      • Favorprep Plasmid Extraction Mini Kit : FAPD1 Buffer (RNase A added), FAPD2 Buffer, FAPD3 Buffer, FAPD Column, Collection Tube, W1 Buffer, Wash Buffer (96-100% ethanol added), Elution Buffer

      Procedure

      • 6ml of well grown bacterial culture was transferred to a centrifuge tube.
      • It was centrifuged at 8000 rpm for 1 minute to pellet down the cells.
      • The supernatant was discarded and 200µl of FAPD1 Buffer was added to the pellet.
      • The cells were resuspended completely by pipetting.
      • 200µl of FAPD2 Buffer was added. The tube was then gently inverted for 5-10 times.
      • It was then incubated at room temperature for 2-5 minutes.
      • 300µl of FAPD3 Buffer was added and the tube was immediately inverted 5-10 times to neutralize the lysate.
      • Centrifugation was done at 13000 rpm for 5 minutes and the supernatant was carefully transferred to the FAPD Column.
      • It was centrifuged at 8000 rpm for 30 seconds and the flow-through was discarded.
      • The column was then placed back in the collection tube and 400µl of W1 Buffer was added to the column.
      • Centrifugation was done at 8000 rpm for 30 seconds and flow-through was discarded.
      • 700µl of Wash Buffer was added to the column and centrifuged at 8000 rpm for 30 seconds.
      • Flow-through was discarded and the sample was centrifuged at 13000 rpm for additional 3 minutes to remove residual ethanol.
      • The column was air dried for 2-3 minutes.
      • Column was placed in a new 1.5 ml eppendorf tube.
      • 100µl of Elution Buffer was added to the center of the membrane and allowed to stand for 2-4 minutes.
      • It was centrifuged at 13000 rpm for 1 minute to elute the plasmid DNA.
      • Plasmid was stored at -20°C.
      • Plasmid was quantified using nanodrop spectrophotometer (Elution Buffer as blank).
      • Plasmid was analyzed through 0.8% agarose gel. Bands were visualized and documented in gel documentation system.

      Note

      • Vortexing should not be done after the addition of FAPD2 Buffer.
      • Incubation should not proceed over 5 minutes on addition of FAPD2 Buffer.
      • Elution should not be carried out using less than the suggested volume.

      Polymerase Chain Reaction

      It is used to amplify a gene sequence using a template strand which has the sequence of interest. DNA polymerase helps in synthesizing new strands of DNA using dNTPs and two sets of primers. Mg2+ required by the polymerase enzyme is supplemented by the Phusion buffer.

      Materials required

      • Template DNA
      • Forward primer
      • Reverse primer
      • dNTP
      • Sterile milliQ water
      • Phusion polymerase
      • 5X Phusion HF reaction buffer
      • PCR tubes and PCR machine(thermocycler)

      Procedure

      Reaction mixture for total volume of 50µl.

      PCR Reaction mixture
      Sl.No.ComponentsFinal concentrationVolume(µl)
      15X Phusion Buffer HF1X10
      210mM dNTP200 µM1
      310µM Forward primer0.5 µM2
      410µM Reverse primer0.5 µM2
      5Template DNA(Genomic DNA)100 ng0.4
      6Phusion DNA Polymerase1 unit0.5
      7Sterile milliQ water-34.1

      Reaction conditions

      • Initial Denaturation : 98°C for 4 min
      • Denaturation : 98°C for 30 sec
      • Annealing : 61.6°C for 30 sec
      • Extension : 72°C for 1 min
      • Final extension : 72°C for 7 min
      • Storage : 4°C

      PCR was done for 36 cycles.

      Note

      • Polymerase should be added only after adding remaining samples.
      • All samples should be assembled in ice.
      • Annealing temperature will be ~2°C less than the Tm.

      PCR Purification

      Materials required

      • QIA quick PCR Purification Kit : Buffer PB(1:250 volume pH indicator I added)
      • QIA quick spin column
      • 2 ml collection tube
      • Centrifuge and eppendorf tubes
      • Buffer PE (ethanol added; 96-100%)
      • Elution Buffer (Buffer EB)

      Procedure

      • 5 volumes of Buffer PB was added to 1 volume of the PCR sample and mixed.
      • QIAquick spin column was placed in a 2 ml collection tube and the sample was applied to the column.
      • Centrifugation was done at 13000 rpm and room temperature for 1 minute.
      • Flow-through was discarded and 0.75ml of Buffer PE was added to wash the column.
      • It was then centrifuged at 13000 rpm and room temperature for 1 min.
      • Discarded the flow-through and centrifuged for an additional minute.
      • Column was placed in a fresh 1.5ml eppendorf tube.
      • 15µl of Buffer EB was added to the center of the column and allowed to stand for 1-2 minute.
      • It was then centrifuged at 13000 rpm and room temperature for 1 minute.
      • Purified sample was stored at -20°C.
      • PCR amplified product was analyzed on 0.8% agarose gel.

      Determination of concentration of purified PCR amplified product

      Concentration was determined using nanodrop spectrophotometer with Buffer EB as blank.

      Restriction digestion (Double Digestion)

      Materials required

      Double digestion
      Reaction mixturepET21bMsdisF3R3
      DNA(µl)510
      Cut smart Buffer(µl)22
       EcoRI(µl)11
      HindIII(µl)11
      Sterile H2O(µl)116
      Final volume(µl)2020

      Procedure

      • Enzymes were added last.
      • All the components were assembled in ice.
      • It was mixed properly after adding all the components.
      • Reaction mixture was incubated at 37°C for ~2.5 hours.
      • Restriction digested products were stored at -20°C.
      • The products were analyzed on 0.8% agarose gel.

      Note

      • Overnight incubation can lead to star activity by the enzymes due to which it cuts non-specifically.

      Gel extraction

      Restriction digested samples were run on 0.8% agarose gel and visualized under UV transilluminator for bands.

      Materials required

      • QIAquick gel extraction kit: Buffer QG, Buffer PE (ethanol 96-100% added), Buffer EB
      • Scalpel
      • UV transilluminator
      • UV screening glasses
      • Weighing balance
      • Centrifuge and eppendorf tubes
      • Hot water bath
      • Vortex
      • QIAquick Spin column
      • 2ml Collection tube
      • Isopropanol

      Procedure

      • The DNA fragments were excised from the agarose gel with a clean, sharp scalpel by observing through UV transilluminator.
      • The gel slices were weighed and 3 volumes of Buffer QG was added to 1 volume of the gel.
      • It was incubated at 50°C for 10 minutes (until the gel dissolved completely).
      • Vortexing was done every 2-3 minutes for dissolution.
      • 1 gel volume isopropanol was added to the sample and mixed.
      • Sample was then applied to the spin column placed in a collection tube and centrifuged at 13000 rpm for 1 minute.
      • Flow-through was discarded.
      • 500µl of Buffer QG was added and centrifuged at 13000 rpm for 1 minute.
      • Flow through was discarded and 750µl of Buffer PE was added to wash the column.
      • Allowed it to stand for 2-5 minutes and then centrifuged at 13000 rpm for 1 minute.
      • Discarded the flow-through and centrifuged at 13000 rpm for additional 3 minutes to remove the residual buffer.
      • Discarded flow-through and air dried the column for 2-3 minute.
      • Column was placed into a clean 1.5 ml eppendorf tube.
      • 50µl of Buffer EB was added to the center of the column and allowed to stand for 4 minutes.
      • It was centrifuged at 13000 rpm for 1 minute to elute the DNA.
      • The purified products were stored at-20°C.

      Determination of concentration of purified double digestion product

      Concentration of gel extracted double digestion product was measured using nanodrop spectrophotometer with Buffer EB as blank.

      Ligation Reaction

      Required amount of insert DNA for DNA ligation was calculated using Ligation Calculator. Vector to insert ratio of 1:3 is normally used for cohesive end (sticky end) ligation.

      Materials required

      Ligation reaction
      Reaction mixtureVolume(µl)
      10X T4 DNA Ligase Buffer2
      Vector DNA2(66ng)
      Insert DNA1(37.5ng)
      T4 DNA Ligase1
      Sterile d.H2O14
      Total volume20µl

      Note

      • All components were assembled in ice.
      • Enzymes were added in the end.
      • Ligation products were stored at -16°C.
      • 0.1% SDS was added to the sample along with the 5X DNA loading dye and heated in dry bath at 65°C for 10 minutes prior to loading in 0.8% agarose gel for analyzing the bands.

      Preparation of competent DH5α cells

      Competent cells are those cells which can take up DNA and be transformed. Competence results from alterations in the cell wall making it permeable to large DNA molecules.

      Materials required

      • RF1 Buffer(50ml):
      RF1 Buffer
      ComponentsFinal ConcentrationQuantity
      RbCl100mM0.60g
      MnCl2.4H2O50mM0.49g
      Potassium Acetate30mM0.14g
      CaCl2.2H2O10mM0.07g
      Glycerol15%6ml

      pH was adjusted to 5.8 with 0.2M acetic acid using pH meter. It was then filter sterilized and stored in a light proof environment.

      • RF2 Buffer(50ml):
      RF2 Buffer
      ComponentsFinal ConcentrationQuantity
      RbCl10mM0.10g
      MOPS10mM0.06g
      CaCl2.2H2O75mM0.55g
      Glycerol15%6ml

      pH was adjusted to 6.8 with 1M NaOH using pH meter. It was filter sterilized and stored in a light proof environment.

      • Primary culture of E.coli DH5α
      • Secondary culture of E.coli DH5α
      • UV spectrophotometer
      • Liquid N2
      • Centrifuge, falcon tubes and microcentrifuge tubes

      Procedure

      • RF1 and RF2 Buffers along with the falcon tubes to which the culture has to be transferred were pre-cooled in the cold room (8°C).
      • 200µl of DH5α were added into 10 ml pre-autoclaved LB tube and this primary culture was incubated in incubator shaker at 150 rpm and 37°C overnight.
      • After overnight incubation, required volume of primary culture was inoculated into another 10 ml LB tube, after checking optical density by serial dilution, for secondary culture.
      • Incubated it in incubator shaker and checked OD600nm until it reached a value of 0.6.
      • At 0.6 OD, the culture was transferred into sterilized pre-cooled falcon tubes kept in ice.
      • It was centrifuged at 4000 rpm and 4°C for 12 minutes.
      • The supernatant was discarded completely by not disturbing the pellet.
      • The pellet was resuspended in 15ml of pre-cooled RF1 Buffer by keeping in ice.
      • It was incubated in ice for 15 minutes.
      • Centrifuged at 4000 rpm and 4°C for 12 minutes.
      • Discarded the supernatant completely and resuspended the cell pellet with 4ml of pre-cooled RF2 Buffer in ice.
      • Incubated in ice for 15 minutes.
      • 100µl of competent DH5α cells were quickly aliquoted into sterilized and pre-cooled microcentrifuge tubes.
      • Tubes containing aliquoted cells were transferred into a pre-cooled box.
      • The cells were freezed immediately in liquid N2 and stored at -80°C.
      • Efficiency was checked by transformation.

      Note

      • Whole experiment should be carried out with utmost care.
      • All the procedure should be done by keeping in ice.
      • Do not pipette or vortex the cells.
      • Gently shake or tap at the bottom of the tube to resuspend.

      Transformation

      Competent cells of DH5α were prepared by using RbCl2. Heat shock method was followed for transformation. pET21b vector was transformed into DH5α cell. After transformation competency was checked by spreading the cells in ampicillin containing LB-agar plate for overnight. Through transformation bacterial cells takes up pET21b from its environment and maintains it in a heritable form. Rb2+ ions bound to the bacterial cell membrane and induced the cell to take up plasmid during heat-shock method as it develops pores. Sudden chilling on ice closes the pores immediately. Antibiotic resistance gene in the plasmid acts as marker [​Fig 2​]​.

      Materials required

      • Competent cells of DH5α
      • Ice and hot water bath
      • Plasmid
      • Sterile LB media
      • Centrifuge and eppendorf tubes
      • LB agar plates containing antibiotics

      Procedure

      • Competent cells of DH5α were taken and stored in ice.
      • 1µl of plasmid was added to 100µl of competent cell.
      • Incubated in ice for 30 minutes.
      • Heat shock was given by incubating in water bath for 1 minute at 42°C.
      • It was then quickly chilled on ice.
      • 1ml of sterile LB broth was added to it.
      • Incubated in incubator shaker at 150 rpm and 37°C for 1 hour.
      • After incubation, it was centrifuged at 5000 rpm and 6°C for 10 minutes.
      • Discarded the supernatant and resuspended the pellet in 50µl LB media
      • It was then poured into LB agar plate containing ampicillin and spread uniformly.
      • Incubated the plates at 37°C overnight.

      Results and discussions

      Isolation of genomic DNA

      M. smegmatis MC2 155 strain was grown to isolate the genomic DNA from which the gene of interest (disA) can be amplified later. On analyzing in 0.8% agarose gel, bands with ~7 Mb size were observed for the genomic DNA which was similar to the molecular weight of M. smegmatis MC2 155 genomic DNA. Concentration of this DNA was measured. Absorbance at 260/280 value was found ~ 1.8, which is pure for DNA.

      g DNA paint.jpg
        Genomic DNA from M. smegmatis MC2 155 on 0.8% agarose gel

        The following results were observed through nanodrop:

        • Concentration of genomic DNA was observed to be 193.4 ng/µl.
        • Absorbance at 260nm (10mm path) was 3.8.
        • Absorbance at 280nm (10mm path) was 2.0.
        • Absorbance at 260/280 (nm) ratio was observed as 1.9

        Bioinformatics analysis of c-di-AMP and disA gene

        Gene sequence for disA gene was taken from NCBI using the gene accession number. Gene size is 1119 bp. Gene accession number is MSMEG_6080. The FASTA format of the gene sequence is given below.

        >NC_008596.1:6143853-6144971 M. smegmatis str. MC2 155 chromosome, complete genome

        ATGGCCGTGAAGTCCGGCGCGAGATCCGGACGCAACGTCGTGCACCTGGCCCGGCCGACGTTGCGCGAGACGCTGGGCCGCCTTGCCCCCGGCACACCGTTGCGCGACGGGCTTGAGCGCATCCTGCGTGGCCGCACCGGTGCGCTGATCGTGCTCGGATACGACGACAGTGTCGAGGCCATCTGCGACGGCGGTTTCGTCCTCGACGTGCGCTATGCGCCGACGCGGCTGCGTGAGCTTTCGAAGATGGACGGCGCAGTGGTGCTCTCCAGCGACGGCAGCCGCATCCTGCGGGCCAACGTGCAGCTGGTCCCCGACCCGTCCATCCCGACCGACGAGTCCGGAACCCGGCACCGCTCGGCCGAGCGCACCGCGATCCAGACCGGTTATCCCGTGATCTCGGTGAGCCACTCCATGAGCATCGTGACGGTCTACGTGGCAGGCGAGCGGCACGTGGTGCCCGATTCGGCGACGATCCTGTCCCGGGCCAACCAGACCATCGCGACGCTGGAACGCTACAAGGGCAGGCTCGACGAGGTCAGCAGGCAGCTCTCGACCGCCGAGATCGAGGACTTCGTGACGCTGCGCGACGTGATGACCGTCGTGCAGCGCCTGGAGATGGTGCGCCGCATCAGCCTGGAGATCGACGCCGACGTGGTGGAACTCGGCACCGACGGCCGCCAGCTCAAGCTGCAGCTCGACGAACTCGTCGGCGACAACGAGACCGCGCGCGAGCTGATCGTTCGCGACTACCACGCCAACCCGGATCCGCCGACGGCCGCGCAGGTCGCCGCGACGCTCGAGGAGCTCGACTCGCTCAGCGACAGCGAACTGCTGGACTTCACGGTGCTGGCACGCGTCTTCGGGTATCCGTCGACCGCCGAGGCCCAGGATTCGGCGATGAGCTCACGCGGTTACCGCGCGATGGCCGCGATCCCCCGGTTGCAGTTCGCCCACGTCGACCTGCTGGTGCGTTCGTTCGGCTCGCTGCAGAACCTGCTGGCCGCCAGCGCCGACGATCTGCAGTCCGTCGACGGCATCGGTTCGATGTGGGCACGCCACATCAGGGAAGGGCTCTCACTGCTGGCCGAGTCGACGATCGCCGACCGGCTGGCCTGA

        Protein sequence (DisA- 40 kDa)

        MAVKSGARSGRNVVHLARPTLRETLGRLAPGTPLRDGLERILRGRTGALIVLGYDDSVEAICDGGFVLDVRYAPTRLRELSKMDGAVVLSSDGSRILRANVQLVPDPSIPTDESGTRHRSAERTAIQTGYPVISVSHSMSIVTVYVAGERHVVPDSATILSRANQTIATLERYKGRLDEVSRQLSTAEIEDFVTLRDVMTVVQRLEMVRRISLEIDADVVELGTDGRQLKLQLDELVGDNETARELIVRDYHANPDPPTAAQVAATLEELDSLSDSELLDFTVLARVFGYPSTAEAQDSAMSSRGYRAMAAIPRLQFAHVDLLVRSFGSLQNLLAASADDLQSVDGIGSMWARHIREGLSLLAESTIADRLA

        Primer Designing

        Forward and reverse primers were designed as described in the Materials and Methods Section. Primers were 24 bp long and had Tm value of 58.1ºC. Tm was calculated using the equation mentioned previously. EcoRI (GAATTC) was added as restriction site in the forward primer and HindIII (AAGCTT) was added in the case of reverse primer. GC content for forward primer was found to be 45.8% and that of reverse primer was 50%.

        Primer Sequence

        disA FP3---- 5′ ATT AGC GAA TTC ATG GCC GTG AAG 3′

        disA RP3---- 5′ GTA ATA AAG CTT TCA GGC CAG CCG 3

        Extraction of plasmid DNA

        pET21b plasmid was extracted from transformed DH5α cells. Plasmid is required as it acts as the vector by taking up the gene of interest and transforming in host cells where it makes multiple copies of it. Extracted plasmid showed circular, single stranded; supercoiled; covalently bonded; linear; nicked/relaxed circular bands when 2µl of samples were loaded along with 1X DNA loading dye in 1% agarose gel. Ampicillin resistance gene present in pET21b acts as a marker for this plasmid [​Fig 2​​]. It also has restriction sites of EcoRI and HindIII.

        paint plasmid.jpg
          . pET28a and pET21b plasmid on 1% agarose gel

          Polymerase chain reaction

          PCR amplification of the gene of interest (disA) was done using the forward and reverse primers. Samples were then run on a 1% gel to analyze the bands. Expected size of ~1.2 kb was obtained after PCR.

          paint pcr.jpg
            PCR amplified product (disA) on 1% agarose gel

            Restriction digestion of PCR product and pET21b vector

            Restriction digestion was carried out for pET21b and MsdisF3R3 using EcoRI and HindIII restriction enzymes. Digested fragments had sticky ends which were then ligated by T4 DNA Ligase. On analyzing on 1% agarose gel, both the fragments showed expected size corresponding to their molecular weight. After restriction digestion single band of plasmid was only visible. To ~500ng vector, 100ng insert was ligated afterwards.

            paint restrictn.png
              Restriction digested products on 1% agarose gel

              Transformation

              Ligated products i.e., pET21b-Msdis, were transformed into competent DH5α cells and plated into LB agar plates containing ampicillin. Colonies were observed after overnight incubation.

              Empty.jpg
              Empty vector
                platenw.jpg
                pET21b-MsdisF3R3
                  Transformed plates

                  Conclusion

                  In this research we attempted to clone c-di-AMP synthesizing gene, disA from M. smegmatis MC2 155. From these DH5α cells, plasmid isolation and restriction digestion of those isolated plasmid need to be carried out before sequencing to check proper insert size. Further, the transformation of these plasmids is needed to be done in E. coli BL21 DE3 cells. Then, DisA protein can be over expressed by IPTG induction followed by purification in Ni-NTA column chromatography.

                  Acknowledgements

                  I would like to express my sincere thanks and heartfelt gratitude to Prof. Dipankar Chatterji, Molecular Biophysics Unit, Indian Institute of Science for allowing me to work in his lab and for providing me an excellent platform for development. I thank him for his valuable guidance and timely discussions, which always inspired me.

                  I am indebted to IASc-INSA-NASI for giving me such a great opportunity to undergo a resourceful project.

                  I am extremely grateful to my mentor Dr. Avisek Mahapa for being supportive and pointing out my mistakes. In spite of his busy schedule he has been a constant support in the lab and has shown great patience during my project. I am thankful for that.

                  I am also thankful to all my seniors in the lab Anushya Petchiappan, Neerupma Bhardwaj, Unnati Patel, Sudhanshu Gautam, Sujay Naik, Pranami Goswami, Jigyansa Mishra, Anil Kumar, Sunita Prakash and Dinesh V for their valuable suggestions and help during the whole span of my work. They were very friendly and I am thankful for the lab treat, food and the wonderful moments I had with them. It has been my privilege to work with these extremely talented and great minds.

                  I would also like to thank my fellow trainees Utkarsh Anil Mahajan, Pallabi Malo, Gautham U, Saranya Kolapalli and Anubhav Dhar for being helpful and supportive throughout my project. I also thank my friends and roommates who gave me wonderful company throughout the stay in Bengaluru.

                  Achan, Amma, Chinnu and my friends for their constant encouragement, blessings and love.

                  References

                  • E. C. Hett, E. J. Rubin, 2008, Bacterial Growth and Cell Division: a Mycobacterial Perspective, Microbiology and Molecular Biology Reviews, vol. 72, no. 1, pp. 126-156

                  • U. Romling, M. Y. Galperin, M. Gomelsky, 2013, Cyclic di-GMP: the First 25 Years of a Universal Bacterial Second Messenger, Microbiology and Molecular Biology Reviews, vol. 77, no. 1, pp. 1-52

                  • Laura Devaux, Pierre-Alexandre Kaminski, Patrick Trieu-Cuot, Arnaud Firon, 2018, Cyclic di-AMP in host–pathogen interactions, Current Opinion in Microbiology, vol. 41, pp. 21-28

                  • Rebecca M. Corrigan, Lisa Bowman, Alexandra R. Willis, Volkhard Kaever, Angelika Gründling, 2015, Cross-talk between Two Nucleotide-signaling Pathways inStaphylococcus aureus, Journal of Biological Chemistry, vol. 290, no. 9, pp. 5826-5839

                  • Rebecca M. Corrigan, Angelika Gründling, 2013, Cyclic di-AMP: another second messenger enters the fray, Nature Reviews Microbiology, vol. 11, no. 8, pp. 513-524

                  • Rebecca M. Corrigan, James C. Abbott, Heike Burhenne, Volkhard Kaever, Angelika Gründling, 2011, c-di-AMP Is a New Second Messenger in Staphylococcus aureus with a Role in Controlling Cell Size and Envelope Stress, PLoS Pathogens, vol. 7, no. 9, pp. e1002217

                  Source

                  • Fig 1: Rebecca M. Corrigan, Angelika Gründling, 2013, Cyclic di-AMP: another second messenger enters the fray, Nature Reviews Microbiology, vol. 11, no. 8, pp. 513-524
                  • Fig 2: Addgene plasmid map
                  More
                  Written, reviewed, revised, proofed and published with